Skip to main content

Table 1 Target complementary regions and unique primer sequences for the PRI-lock probes.

From: Quantitative multiplex detection of plant pathogens using a novel ligation probe-based system coupled with universal, high-throughput real-time PCR on OpenArrays™

Targeted species/group 5' Target complementary sequence (5'-3') 3' Target complementary sequence (5'-3') Forward primer sequence (5'-3') Reverse primer sequence (5'-3')
Phytophthora spp. TATCTAGTTAAAAGCAGA GACTTTCGTC CTGCTGAAAGTTGC TACGAACGTCTTAGCACTCC GGTGTTGATTCGCGTCTACT
P. infestans TCGATTCGTGGTATGGTTGGCTTCGGCT CGTTAATGGAGA AA TGC AGAGTCGGTAGGCACTATGG CGTATGTCGAATGCAGCTGA
R. solani AG 2-2 TCTGCCTCACAGGTTCACAGGT GTGTGTGG TTCC CGTCCA TG TC GAGTTCCCGTGCGTTAGATC TACGGCGCTTGGGACATGAT
R. solani AG 4-1 GGTCCAATAAAGTT CCTTC CCCCCTAG AAAA AGTCCAA_G GA GAGTA___ CGTGTCCATCGAGCTGCATA GACGGCATTCAGAGTACGCT
R. solani AG 4-2 GACTTCTGTCTACTTAATTCATATAAACTCAATT CTT _CTACTCCC CCTT_ CTGCCTGTGACTCGTGTATC AGACCGTATCGTCCACAGTG
F. oxysporum GCGAGTCCCAACACCAAGCTGT GCTTG GGAACGCGAA TTAAC_ CTGGTGCATGTACTCGACTG ATCAGATCGACTCGGTAGCT
M. roridum CGGT GGTGGCCATGCCGTA AAACACC A CTCGCA TTGGAG CT CATCCAGCTCAACGTATCCA CCTACTGTGACGCTGTGATG
V. dahliae TTTATACCAACGATACTTCTGAGTGTT CATCAGTCTCTC TG ATCTGGATCAACGTCGCGCT ATACAGTCGTCGGGGTCGAA
V. alboatrum/V. tricorpus TTTATACCAACGATACTTCTGAGTGTTCTTAGTGAAC G TA CATCAGTCTCTT TA GCATCGGGTTCACGCCTATA TGAAGCACTGACACGCGAAG
M. hapla GT TTAT CGTTGTGAATGGCTGTCGCTGGTG ATTC GAATA GTCTC AAC TATGGGTCTTGCTGATACGC TCCGTCTGTTGAGTTAGGCC
E. carotovora carotovora AAAACCTGTGCGTTC ATCGATGCTGAACAT TCAA CGCGAAGGA AGAATCGTACACGCTGCTGG AATACGACTGACACGAGCTG
A. tumefaciens TCCGGTTGAT AGTTGAGGACAG CATTGGAC GTTGGTCGTCCGCT CAATACCTGTGACGAGCTGG ACCCGGTCACTCAGCATATA
G. Proteo bacterial spp. GGCCTTCTTCACACACGCGGCATGGCTGCA GCTTTACAACCCGAA ACAGGTCATCGAACTCTCAC AGAACACGTCAGAGGTCCGT
Internal Ligation Control (ILC) GGGAGAACACTGCGTGGTTTTCACATAC GCTTGTGCCTCTCGA CTATCGCGTGCTAGTCGTCT ATTCTAATCAATCGTCGCGG
  1. Nucleotides highlighted in bold font, indicate polymorphism within the target group. Nucleotides or gaps owing to deletions used to discriminate from most similar, non-target sequences, are underlined. (No such sequence was found for the PRI-lock probes G. Proteo bacterial spp. and A. tumefaciens)