Skip to main content

Table 1 Designations and sequences of primers used in RT-PCR

From: Revised genomic structure of the human ghrelin gene and identification of novel exons, alternative splice variants and natural antisense transcripts

Primer name Primer sequence (5'-3') Exon Ta (°C) PCR Cycles
V0-F GAACATTTTTAGTTCCCAAGGAATG 0   
V0-R CTCTCTGGTGTTCAGGGCTC 1 62 40
EX-1-F AAGATAACACAGCTTTGCACAG -1   
EX-1-R CTCTGGTGTTCAGGGCTCAG 1 59 40
Sure-F TTCGTCACTCCGTGAATCAG N/A   
Outer-R TGGCGTTTGTTCTAAACCAG 0 59 → 57 25 (10 → 15)
Inner-R GGCTGATGTACATTCCTTGG 0 59 35
Exon-1-Full-F GTGGATGTTTACTTGCTGGTG -1/-1* #   
Exon-1-Full-R GTTTGAACATTTATTCGCCTCC 4/4* # 61 35, 40
V-long-ex0-F GAGGATGATCAGGAGCAGTC 0   
V-long-ex0-R CAGTTTGAACATTTATTCGCCTCC 4 59 40
B2MG-F TGAATTGCTATGTGTCTGGGT 2   
B2MG-R CCTCCATGATGCTGCTTACAT 3 55 25
cRNA-exon-1-F CCCAAAGATAACACAGCTTTGCAC -1   
cRNA-exon-1-R CTAATACGACTCACTATAGGGAGA TGGACCCTGGAGGCCTCT -1 64 30
CF264800-F ATGAGCGCTTCTAAACTTAGAG 4/4*   
CF264800-R GCTCCTGTTTCCTAAGATGTC 2* 59 30, 35, 40
ex2*-nested-South-F GCATTTGCCTCAGCGGT 2*   
ex2*-nested-South-R   2* 59 30
5'adapter-out-F CTGATGGCGATGAATGAACAC N/A   
5'OS-out-R TCTCTAAGTTTAGAAGCGCTC 4* 59 35
5'adapter-in-F ATGAATGAACACTGCGTTTGCT N/A   
5'OS-in-R TCTAAGTTTAGAAGCGCTCATCTG 4* 61 35
  1. T7 promoter sequence in primer cRNA-exon-1-R is underlined. Primers in exon -1 and 4 also span antisense exons (-1* and 4*, respectively) as indicated where appropriate (#).