Skip to main content

Advertisement

Table 10 Primer sequences for Real Time-qPCR analysis of transcript accumulation

From: MELOGEN: an EST database for melon functional genomics

Gene Primer sequence (5'->3') Forward Reverse
CTL1 tgggccatgttggctctaag ctcccgtgacaactccatca
CYP 7 cgatgtggaaattgacggaa cggtgcataatgctcggaa
EIF4A-2 ttcccgaggtttcaaagatca ccaatgcttctggtggcact
EIF4E ttcggttccttcccttccat ccgccgatgtagctttcatc
EIN4 tgcaacgtgactgctgtttct tctggcatgtgaagatccaaga
GA2OX1 tagggcaaatcggttagcga ccaaatgcaaaccgattgaa
HSP101 aacgtatggtgcggattgaca tccaccttcatggtatccaacat
HSP70 gctgaggcgtaccttggaaa atcctgccagcatcctttgt
IAA9 gacggaaagccaggttcaag cccctccatactcactttcacaa
LSM1 ctacttcgagatgggcggaa tcaccaacgatcaccctttca
LUT2 gctggcgtggaacactcttt cgaatgccttcaatgtccagt
NCBP cgtcggtctgcttaatttgca cgcctacgaactccattgaca
SVP cgaggcaggtcacgttctct agagaagacgaggagcgcaa
HIR tgacgggctcagagacagtg gttccagggacgttttcagc
TCH4 ggagggtagccttgagggaat ctggacattgctcgacaacaa
TIP4 tccttgctggtgtcggatc cgtttgccaataacgcattg
TOM1 gggagaaggaagaaacttcatgag gcgtcaaaagcggataaagc
TOM2A ctcctcagcagccgaagaaa tggacccgctaaaacaccac
TOM3 aatggagttcgggctgttgt aaggcaaggcttggcatgt
UGE5 gcgaaagtgtccaaaagcca acacaagctttttgcatccgt
WRKY70 ggattgctcctggcctgac tcggctgcttttcttcgatc