Skip to main content

Table 3 PCR primers used in this study.

From: Architecture of Burkholderia cepacia complex σ70 gene family: evidence of alternative primary and clade-specific factors, and genomic instability

DNA targets PCR primer code DNA sequence position on Bcen-J2315 genome annealing temperature
ecfA1 region A CACGGTCATCACGCTCGC Chr1 3124945-3124962 55°C
ecfA1 and ecfA2 region B TTCGGTGCGATAACCAGC Chr1 1056358-1056374 55°C
ecfA2 region C CGGGCGCAAGAACATACA Chr1 1056771-1056789 55°C
ecfB ecfB-F CGCTTCGCGCTCTGGCTG Chr1 3817718-3817735 58°C
ecfB ecfB-R TCAGCCGCAAGGAAGGAGC Chr1 3818171-3818153 58°C
ecfD ecfD-F CGCAACTGCGGCGCCCG Chr1 2115044-2115060 55°C
ecfD ecfD-R CGAGCGTTTCGAGCGGGTC Chr1 2615449-2615467 55°C
ecfE ecfE-F GTGAACGAACGAGGCTAGG Chr1 2728191-2728210 55°C
ecfE ecfE-R CTCCTTGAAGGACTGTCC Chr1 2727807-2727824 55°C
sigI sigI-F ATCCCGCTCGATGCCGCGC Chr2 2667864-2667882 55°C
sigI sigI-R GAGAATTTGAAGCCGCGCCG Chr2 2668242-2668261 55°C
sigI sigIv-F ATCATGCCCGCTGGCTC Chr3* 1181202-1181218 55°C
sigI sigIv-R AACAGCCCGATGTTGCCT Chr3* 1181508-1181491 55°C
sigJ sigJ-F CATGCGCATGGCACCCGTTC Chr2 1383013-1383032 55°C
sigJ sigJ-R GAGAATTTGAAGCCGCGCCG Chr2 2668242-2668261 55°C
  1. * Position on B. vietnamiensis G4 genome