Skip to main content

Table 3 Equine OAS1 and RNASEL haplotypes

From: Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

Gene Haplotype Sequence Count Frequency
OAS1 CTGTCATTCGCTGGAACCCTAGGTCGTAACCTT 0.08
  CTGTCTTTCGCTGGAACCCTAGGTCCCATGCGT 0.04
  CTGTCTTTCGCTGGAACCCTAGGTCCCGTGCGT 0.08
  CTGTCTTTCGCTGGAACCCTAAGTCCCGTGCGT 0.04
  TGACTACCTGCCGCCATCCTAGGTCGTAACCTT 0.19
  TGACTACCTGCCGCCATCCTAGGTCGTAAGCTT 0.04
  TGACTACCTGCCGCCATCCTAGGTCGCAACCTT 0.04
  TGACTACCTGCCGCCATCCTAGGGCGTAACCTT 0.04
  TGACTACCTGCCGCCATTTCGAATCCCGTGTGT 0.11
  TGACTACCTGCCGCCGTTTCGAATCCCAACCGT 0.08
  TGACTACCTGTCGCCGTTTCGAATCCCGACCGG 0.08
  TGACTACCTCCCACCATTTCGAATCCCGTGTGT 0.04
  TGACTACCTCCCACCATTTCGAAGCCCGTGTGT 0.04
  TTGTCATTCGCTGGAACCCTAGGTTCCGTGTGG 0.08
  TTGTCATTCGTTGGCACCCTAGGTTCCGTGTGG 0.04
RNASEL GACTGCAAAGGGAGCGCTGGGCAGTTTCTTT 0.07
  GATCGCAAGGACGGCGCTGGGCACACCCCCC 0.04
  GATCGCAAGGACGGCGCTGGGCACACCTCCC 0.12
  GATCTCACAGGGAGCGCTGGGCAGATTCTTC 0.12
  GATCTCACAGGGAATAACAAGTGGACCCCCC 0.12
  GATCTAGAGGACGGCGCTAGGCAGATTCTTC 0.07
  GCCCGCAAGGGCGGCGCTAGGCAGATTCTTC 0.23
  GCCCGAAAGGGGAATAACAAGTAGATTCTTC 0.07
  GCCCGAAAGTGGAGCGCTGGGCAGTTTCTTT 0.04
  CCCCGAAAGTGGAGCGCTAGACAGACCCCCC 0.12
  1. Haplotypes were assembled using PHASE v2.1 [40, 41] under default settings. The haplotypes identified from the best reconstruction are shown with their corresponding frequencies among the 13 horses screened for both OAS1 and RNASEL SNPs. Both OAS1 microsatellites were omitted from the haplotype reconstruction.