Skip to main content

Table 4 RNASEL primers

From: Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes

Species Forward primer Reverse primer
Cat CAGGCATCCAGAAGGGAGAC CAGAGGCAGCCAATCTCTCC
Cattle/Dog GCTGGTCACCTTTGCATAATGC CCCAACTCCAAAAGAAGGGATG
Domestic pig ATGGAGACCAAGCGCCATAACA TGTTCTCCCAAGTTCCGGATGA
Elephant ATATCCCTACTAGCCTGACGAG TTGCCTTGACACCCCCAATTCT
  AGCTGTAGGATGTAACTCTCACT GATTAGAGGAACCACTGAGAGG
  GCGGTACCTCATTGTGGTTTTG CCTCTGTATCTTCATGGTCTGG
  TGCCTTTGAATTGTGGTGTTGGT CCATGTGGTGGATTCATTATAGG
  GTTGAGGTGTCAGGATCTGCAT GGGGTAACACTGGAACTGTTTC
Guinea pig TAATGGTCTGGACCATTCCTCC GTTTGAGGAAAGTGCCTTGCGT
Horse TTCACRGCYTTCATGGAAGC CYTTKATCAAAATCTGCCAG
  1. Primers used to assemble the full-length RNASEL mRNA sequences of cattle, dog, horse, cat, domestic pig, Guinea pig, elephant and opossum.