Skip to main content

Table 1 Primer pairs used for characterization

From: Alternative splicing of TGF-betas and their high-affinity receptors TβRI, TβRII and TβRIII (betaglycan) reveal new variants in human prostatic cells

Gene (Acc No)a Position Designation Size Sequence ATb
TβRI, human, 256–275c 5-TB1RL 288 bp GACCACAGACAAAGTTATAC 60°C
(NM_004612) 524–543 3-TB1RL 300 bp TGGTGAATGACAGTGCGGTT  
(AJ619019) 159–178 3-HTB1RL 178 bp TACTGAAAAAGGGCCAGTAG 52°C
TβRII, human 435–454 5-HTBR2B 274 bp CGCGTATCGCCAGCACGATC 63°C
(NM_003242) 688–708 3-HTBR2B 349 bp TGGTAGGGGAGCTTGGGGTCA  
(NM_001024847) 795–815 5-HTBR2E3 298 bp GTAGCTCTGATGAGTGCAATG 60°C
  1072–1092 3-HTBR2E4 406 bp TGGTTGATGTTGTTGGCACAC  
TβRIIC, human 89–108 5-HTBR2Z 319 bp GGAGCACTTGTCAAAACACTG 57°C
(AJ786388) 84–115 3-HTBR2CD 115 bp TCCCAGCCAGTGTTTTGACAAG 60°C
TβRIII, human 2501–2520 5-HTBR3E13 217 bp TGTGTGCCTCCTGACGAAGC 59°C
(NM_003243) 2609–2717 3-HTBR3E15   AGGCTGCAAACGCAATGCCC  
TGF-β1, human 1402–1420 5-HTGFB1E3 426 bp TGGCGATACCTCAGCAACC 55°C
(NM_000660) 1809–1827 3-HTGFB1E6   GTTGGCATGGTAGCCCTTG  
TGF-β2, human 680–699 5-HTB2CP 185 bp CAACAGCACCAGGGACTTGC 65°C
(M19154) 845–864 3-HTB2CP   AGCACAAGCTGCCCACTGAG  
(NM_003238) 658–679 5-TGFB2E1B 272 bp CCCCGGAGGTGATTTCCATCTA 62°C
  908–929 3-TGFB2E1B 188 bp GTAGGGTCTGTAGAAAGTGGGC  
TGF-β3, human 342–361 5-TGFB3E1 332 bp TGGACTTCGGCCACATCAAG 57°C
(NM_003239) 653–673 3-TGFB3E2   CTCCACTGAGGACACATTGAA  
GAPDHd, human 402-421 5-GAPDH 300 bp CGTCTTCACCACCATGGAGA 59°C
(NM_002046) 682-701 3-GAPDH   CGGCCATCACGCCACAGTTT  
  1. aAcc No, EMBL/DDBJ/GenBank Accession Number
  2. bAT, annealing temperature
  3. cthis position is equivalent to 1–20 in AJ619019
  4. dGAPDH, glyceraldehyde-3-phosphate dehydrogenase