Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Sequences of oligonucleotide primers used in semi-quantitative RT-PCR validation experiments

From: Transcription profiling of a recently colonised pyrethroid resistant Anopheles gambiae strain from Ghana

Gene Accession number Primer Sequence (5' to 3') Transcript length
CYP6M2 [GenBank: AY193729] CYP6M2_F
CYP6M2_R
GTATGATGCAGGCCCGTATAG
GCCATAATGAAACTCTCCTTCG
112 bp
CYP307A1 [GenBank: AY745209] CYP307A1_F
CYP307A1_R
ACTACGAGCTGAACACGAGTGA
ATGCAGGTCCGTTTACCAATAC
253 bp
S7 ribosomal [GenBank: AY380336] SPC
SPD
GTGCCGGTGCCGAAACAGAA
AGCACAAACACTCCAATAATCAAG
472 bp
  1. Only genes are listed which showed at least a two-fold difference in one or both strains. p-values were corrected for multiple testing as described in the materials and methods section. n.s., p = 0.001. *CYP6Z1 was spotted on the detox chip as both cDNA and 70-mer oligonucleotide probe [16].