Skip to main content

Table 5 Sequences of the primers used in this study

From: Effects of iron loading on muscle: genome-wide mRNA expression profiling in the mouse

Symbol Name GenBank Accession No. Forward primer (5'-3') Reverse primer (5'-3') Source
Angptl4 Angiopoietin – like 4 NM_020581 CACGCACCTAGACAATGGA AGAGGCTGGATCTGGAAA *
Pdk4 Pyruvate dehydrogenase kinase, isoenzyme 4 NM_013743 GATTGACATCCTGCCTGACC TCTGGTCTTCTGGGCTCTTC *
S100a8 Calgranulin A, S100 calcium binding protein A8 NM_013650 GGAAATCACCATGCCCTCTAC GCCACACCCACTTTTATCACC *
S100a9 Calgranulin B, S100 calcium binding protein A9 NM_009114 CGACACCTTCCATCAATACTC GAGGGCTTCATTTCTCTTCTC *
Fos FBJ osteosarcoma oncogene NM_010234 CGGGTTTCAACGCCGACTA TTGGCACTAGAGACGGACAGA RTprimerDB, 3328
Myl4 Myosin light polypeptide 4 NM_010858 GGGTAAAGCACGTTTCTCCA AGGGAAGGTTGTGGGTCAG *
Myl7 Myosin light polypeptide 7 NM_022879 TCACCGTCTTCCTCACACTC GCTGCTTGAACTCTTCCTTG *
Acta1 Actin alpha 1 NM_009606 CCAAAGCTAACCGGGAGAA CCCCAGAATCCAACACGA *
Cxcl7 Chemokine (C-X-C motif) ligand 7 NM_023785 GCCCACTTCATAACCTCCA ATCACTTCCACATCAGCACA *
Tfrc Transferrin receptor 1 NM_011638 TCATGAGGGAAATCAATGATCGTA GCCCCAGAAGATATGTCGGAA QPPD, 1607
Scd1 Stearoyl-Coenzyme A desaturase 1 NM_009127 TGGGTTGGCTGCTTGTG GCGTGGGCAGGATGAAG QPPD, 1847
Adn Adipsin, complement factor D NM_013459 AACCGGACAACCTGCAATC CCCACGTAACCACACCTTC *
Mup1 Major urinary protein 1 NM_031188 CTCTATGGCCGAGAACCAGA AGCGATTGGCATTGGATAGG *
Dnajb1 DnaJ (Hsp40) homolog, subfamily B, member 1 NM_018808 CGACCGCTATGGAGAGGAA GCCACCGAAGAACTCAGCA *
Hspa1b Heat shock protein 1B NM_010478 GAGGAGTTCAAGAGGAAGCA GCGTGATGGATGTGTAGAAG *
  1. * designed using Primer3 http://puma.fmvz.usp.br/primer3/primer3_www.cgi