Skip to main content

Table 3 Species specific PCR primer pairs used for amplification of fragments from the mitochondrial genome of Pseudocellus pearsei.

From: The complete mitochondrial genome of Pseudocellus pearsei (Chelicerata: Ricinulei) and a comparison of mitochondrial gene rearrangements in Arachnida

Primer name Nucleotide sequence (5'-3') Annealing temp.
Rici-12s-co1 CCACATTACAACATAGTAACTCATTTC 56°C
Rici-co1-12s AAGTTCACCCTGTTCCTGCTC 56°C
Rici-co1-co2 ATTACGTTGTAGCACACTTCCAC 56°C
Rici-co2-co1 AGATGGTAATGTTAGTAATATTTGGTG 56°C
Rici-co2-co3 GTAACATCAACTCTAGCACTAACAC 50°C
Rici-co3-co2 GTGTCGTGGAAATTGGGA 50°C
Rici-co3-cob CTATCAATCTAACCCAACAAAAAAG 54°C
Rici-cob-co3 GTCAGAAGATAGTTTATTGGAATATTGGC 54°C
Rici-cob-12s CCACCATTAACACCCAAAGCC 56°C
Rici-12s-cob TTGGATTTAATAGTAAGGAAGTATTAGATAGG 56°C