Skip to main content

Table 3 Real time qRT-PCR primer sequences, optimum primer concentrations and amplicon sizes for all validated genes.

From: Innate gene repression associated with Mycobacterium bovis infection in cattle: toward a gene signature of disease

Array feature/Clone ID Gene symbol Forward primer (5'-3') Reverse primer (5'-3') Amplicon size (bp) Primer conc. (nM)
Reference gene H3F3A CATGGCTCGTACAAAGCAGA ACCAGGCCTGTAACGATGAG 136 100
PCR Amplicon ACTB AAGCCGGCCTTGCACAT TAACTCGAGAGCCAACGTCTCC 66 900
NBFGC_BE752490 ADAM17 TCAAAGTCGTGGTGGTAGATGG AATTAGTCTCCAAAGCGGCTCT 188 900
NBFGC_AW656779 AKT1 GAGTACTTCAGGGCCGTCAG GGTGATCCTGGTGAAGGAGA 160 900
PCR Amplicon BCL2 ATGACTTCTCTCGGCGCTAC ATGACCGAGTACCTGAACCG 244 300
PCR Amplicon CCL1 AGGCTGGATCTGCTCCCAAAT GGTGATGTGTGCAAGTTCACCA 152 900
BOTL0100003XA07R CD81 TTCATGTCCTGAAGCTCCCTGT TGAAGGCATAAGGCTGCTCGT 284 300
BOTL0100013_C12 CD84 TAAGTGGTGTGTCATGGCAGGT GGCTGGAGGCTGAATATGACTG 103 300
PCR Amplicon CXCR3 GAAAGCAGTGTGGACATAGCCA CGGAACTTGACACCCACAAAG 101 900
NBFGC_BF230159 EEF1G TGGATGCTCACTTGAAGACG ACTGGGCCATTTTCTCACAG 222 300
PCR Amplicon GAPDH CTCCCAACGTGTCTGTTGTG TGAGCTTGACAAAGTGGTCG 222 300
BOTL0100013_E07 IER5 AAGACCCCCGAGACTTCG ACACTCTTCAAGGCGGAGAG 115 300
PCR Amplicon IFNG TGATGGCATGTCAGACAGCA GGCACAAGTCATATAGCCTGACAC 51 300
PCR Amplicon IL2 CTTGCACTCGTTGCAAACG CAAGCTCTCCAGGATGCATACA 183 300
PCR Amplicon IL4 GCCACACGTGCTTGAACAAA TCTCAACAGCTTGGCAAGCA 63 300
PCR amplicon IL8 AGGTGGTGTTTGAAGCCCAT CACAACCTTCTGCACCCACTT 123 900
PCR Amplicon IL16 CGCGGTTTGAAGAATGGAAC TCACAGGTCCATCAGGCAAC 51 300
PCR Amplicon MCL1 AGGTGACTGAAAGGCCTGTCTC CAACATGTGCCTCTTCTCCCT 244 900
BF775342 NFATC4 NFATC4 AACCACTGCCCCTCTCTGAAAC CCTCGACCCCAGATCACAAAGA 107 300
BOTL0100003XF01R NFKB1 ATACTGAACAATGCCTTCCGG CACGTCAATGGCCTCAGTGTAG 135 300
BOTL0100013_G05 PHB2 GGCGGCGCGGATGT AGGTTATATCAAGCTACGCAAGATCC 65 900
NBFGC_AW335987 PRKCB1 ATCGAGAGGGAGGTCCTCAT GGTCTTGGTCTTCTGCTTGC 141 300
PCR Amplicon RPL19 AATGCCCGAGAAGGTAACCTG GGATATGTTCCATGAGGATCCG 164 100
NBFGC_AW669767 RPS6KB2 TGTGGAACTGGCCTATGCCTTC AAGATGCCTTCTCGCTCCAGGT 105 300
PCR Amplicon STK17B ACAGGCCCTCTTGTAATGGCAC AGCAAATCGGACACAAGCTCG 136 300
NBFGC_BE479784 TBK1 TGGACCAATTGACTGGAGTGGA TGATCTGCCTCAAGGATGTTTG 105 300
Not represented TLR2 CCATTGACAAGAAGGCCAT AACCCTTCCTGCTGAGTCTCAT 107 900
Not represented TLR4 CGAGAGCACCTATGATGCCTTT ATGGCCACCCCAGGAATAAA 144 900
PCR Amplicon TNF TCTACCAGGGAGGAGTCTTCCA GTCCGGCAGGTTGATCTCA 68 300
  1. Clone IDs were obtained from the Center for Animal Functional Genomics (CAFG) website [51].