Skip to main content

Table 6 PCR primers and conditions for identification of SNPs in TLR2.

From: Identification of single nucleotide polymorphisms in bovine CARD15 and their associations with health and production traits in Canadian Holsteins

Exon Primer name Sequence, 5' → 3' Tann, °C Amplicon size, bp
TLR2 PROMOTER     
Part 1 Forward CCCTTGAATGTATTTGTCACTTCC 60 664
  Reverse TCCATATTTTTGAGAATCTGACTGA   
Part 2 Forward TGCAAGGATTACAGCAGATTTTC 59 579
  Reverse AAAATCATGTATTTACCCACAACG   
Part 3 Forward CGTACAAAGATGTGCCAGAGG 59 586
  Reverse CCAGTGTTCTTGCCTGGAGA   
Part 4 Forward GGGGCCTTTAATGAGACCTG 60 445
  Reverse GCCCTTCCTAAATTGAGATCAGA   
Part 5 Forward GTGCCTTTGCAATGAGGACT 60 496
  Reverse GCCTGAAGAGCAGATGAGGA   
TLR2 GENE     
Part 1 Forward GCCATGATGTCAAACACAGTCA 58 613
  Reverse AGCACTGATCTCAAGCTCCTCA   
Part 2 Forward CAAAACACTTGGGGAAACATCT 59 611
  Reverse TTTTAACTCTGCCTGTGAGTGGA   
Part 3 Forward ACTGTACCCATGATGGAATTGG 61 643
  Reverse ACGGGTAAGAAGGAGGCATCT   
Part 4 Forward CACAGTTTAACCCAGTGCCTTC 59 633
  Reverse CATGAGGTTCTCCACCCAGTAG   
Part 5 Forward CGGACTGTGGTACATGAAGATG 60 643
  Reverse TCAGCATCAGTTCTTCCAATGA   
\