Skip to main content

Table 7 PCR primers and conditions for identification of CARD15 single-nucleotide polymorphisms.

From: Identification of single nucleotide polymorphisms in bovine CARD15 and their associations with health and production traits in Canadian Holsteins

Exon Primer name Sequence, 5' → 3' Tann, °C Amplicon size, bp
CARD15 PROMOTER     
Part 1 Forward CCCCACTTCTATCCTCTGGACT 58 640
  Reverse AGCAGAGGAAATCTCTCAGCAG   
Part 2 Forward GACTTGGCCATGCCTACTCTAA 59 601
  Reverse GAAACTGAGGCAGCCAGGTAG   
Part 3 Forward TAGACACAGAGTGCTGGCAAGA 58 625
  Reverse CCCGCAAAGATCATTAGGTTTA   
Part 4 Forward TCTTTCCTATCTGCAGCTGTCC 59 632
  Reverse AAGTCCCATCTCTGTCCTAGCC   
CARD15 GENE     
1 Forward TGTAGACAGACGCTGGAGTTCCTCT 62 322
  Reverse ATGCACTGACTCCCATCTACTGCTC   
2 Forward GAGAAGCCCTGCCCTGACCT 63 599
  Reverse ACTATGACCCACATCTCCCCACAG   
3 Forward TGCATCTTACCATGCAGATGTTTTTC 62 392
  Reverse GAGACGCTGAGTTTTACGGAGGTTT   
4 (part1) Forward CTTGTTAGTGGAGAGCCAGGAC 58 546
  Reverse AACAGCAGTGTTCGAAGAGCA   
4 (part2) Forward TTCTCTTCGTCTTCCCATTTAGC 59 506
  Reverse GGACACCATCCAGGAGAAGAC   
4 (part3) Forward CATCGAACTGTACCTGAGGAAGC 60 594
  Reverse AGGAACAATTTGGGCAGCAC   
4 (part4) Forward TCAGACATCTCTTCCAAGATCACA 59 680
  Reverse ACTCCTGGCTCCCAGCATAA   
56 Forward GGGTTAAGCAAAAGTCTCTGTGG 59 595
  Reverse AATGAGACACTGTCCTTGTTTTCAG   
7 Forward CAGGTCTTGGGAGCAGTAAGG 59 375
  Reverse ACATCCTGAGCTTCCTGTTTATTG   
8 Forward CTCACTTGCTGGGACCTGAGT 59 285
  Reverse TCCCTCCTCACACTGGCTTC   
9 Forward AACGATTAGTCTGAAATGGAGCAG 58 300
  Reverse TACACACACATCAGCTTCCACAG   
10 Forward CCTTACACTTTGCTTGACCTGTTT 58 472
  Reverse ACCCCGAAAGATTGTTTTCTAGG   
11 Forward GAATTCATTGGGAATCTCAGACAG 59 355
  Reverse CAGGACTAGAGGTCTGAGCCATAA   
12(part1) Forward ACAGGTTTACAAAGCAGCATCTTC 59 578
  Reverse ACCACTCAACCTGATGGATGAC   
12(part2) Forward GGCTGGTCTCAAGTCAAGCTG 60 619
  Reverse GCACAAACAAAACCAAACCATC   
12(part3) Forward GAACAACTCTGTATCCAAATGCAAC 59 641
  Reverse ACGCTGGGCTAGACTTCTCTAAAC   
12(part4) Forward TCTCCTTGAAGGGAGGAGACAT 59 509
  Reverse CACAACGCTGTAAATCAACCATAC   
12(part5) Forward GGCCTTGGTGAAATAATTCTTAGC 58 588
  Reverse CAGCAACATGGATGGATCTAGAAA   
\