Skip to main content

Table 8 The tetra-primer Amplification Refractory Mutation System-PCR primers and conditions for genotyping CARD15 SNPs.

From: Identification of single nucleotide polymorphisms in bovine CARD15 and their associations with health and production traits in Canadian Holsteins

Position Primer Name Sequence, 5' → 3' Tann, °C Amplicon size, bp
c.2886-14A>G Forward inner primer
Reverse inner primer
Forward outer primer
Reverse outer primer
CAAGCATCCTCAAAGTTCACCATTA TG
GTGGTTGTTAGACAGCCTAGAGAGGAAT AT
CCTGGCACTAAAATGCACGTATTTTTAT
AGTTATACGTTGGAAAACTGAGGCTCAG
60°C 405bp(outer)
300 bp (allele 'A')
150 bp (allele 'G')
c.3020A>T Forward inner primer
Reverse inner primer
Forward outer primer
Reverse outer primer
GAGGAAATTGAGAAACTCAGCCAG CA
AAACATCAGAGCAAGAGTCTGGTATG CA
CTGACAGAGGGTAAAACCTGCACAGACG
CTGTGCCAGAACAAAGGTGACCTATTG
59°C 310bp (outer)
197 bp (allele 'A')
166 bp (allele 'T')
c.4500A>C Forward inner primer
Reverse inner primer
Forward outer primer
Reverse outer primer
AGAGACGCAAGCAGGCCCCTGGGCCG CA
CCCTGGAGACACTTGGAGAGAATGGG GG
AGCAGTGTTTAGAAATAGCCTCGCAAT
AGAGAACCCACACACATGCCCTTACTG
64°C 400bp (outer)
250 bp (allele 'A')
150 bp (allele 'C')
c.4950C>T Forward inner primer
Reverse inner primer
Forward outer primer
Reverse outer primer
TGTATCCATTCAATATATAATACATTG GC
GGCTAGCAAATGTATTATGAGGTG AA
TTCATTTGTTTGAATTTATTTTATTGAGG
GAATGTAACACAAAGGAACATATCTACAA
59°C 341bp (outer)
226 bp (allele 'T')
169 bp (allele 'C')
\