Skip to main content

Table 2 Predicted terminators in Xp10, Xop411, and OP1 genome.

From: Comparison of Genomes of Three Xanthomonas oryzae Bacteriophages

Terminator name Phage Positions Sequence Energy score Tail score Identity/aligned base
TR1 Xp10 1390~1411 CTGCCC TACTTATGGGCAG TTT 7.4 3.5 12/12
  Xop411 5704~5735 GGGAGGGGC TGGGGGAACTGGCCCCTCTC TTT 12.4 3.4 18/18
TR3 Xp10 19285~19308 GGGGCAGG GTTTCCTGCCCC ATTT 15.0 3.3 16/16
  Xop411 18320~18343 GGGGCAGGG TTTCCTGCCCC ATTT 15.0 3.3 16/16
  OP1 19466~19489 GGGGCAGG CTTTCCCTGCCC CTTT 14.0 4.4 16/16
TR5 Xp10 42740~42759 CTGAACG ATCCGTTCAG TTT 10.9 3.5 14/14
  Xop411 43861~43880 CTGAACG GCTCGTTCAG TTT 10.9 3.6 14/14
  OP1 42375~42394 CTGAACG ATCCGTTCAG TTT 10.9 3.8 14/14