Skip to main content

Advertisement

Table 3 Real Time PCR results confirming differential expression identified by microarray analysis

From: Microarray analysis of iron deficiency chlorosis in near-isogenic soybean lines

Clone ID Forward Primer Reverse Primer Federated Ratio Fold Change Identified by Real Time RT PCR Fe Efficient Standard Error Fe Inefficient Standard Error
Gm-c1028-4867 CAGTGGAACTTCGTTGGG AAAAGGCCTGGAATGCTC 2.379 7.56 0.345 0.255
Gm-c1004-8188 CCCTGATCTAGAAGTTGG GCAGGAGCAGATGGTAGC 2.412 2.9 0.185 0.015
Gm-c1028-5360 CAGTGGAACTTCGTTGGG AAAAGGCCTGGAATGCTC 2.701 2.7 0.115 0.030
Gm-c1004-5020 GAAGAACAGCGAAACCTAAC CGGCTACTCCCTATCCA 2.772 2.7 0.020 0.040
Gm-c1028-2326 CAAGAGCATGATCTACCAGC GGACAGAGGGAGAGATCAGG 3.156 2.82 0.080 0.040
Gm-c1013-2943 CGAACCCAAACAAGATACAC GATTGTATTTCCCGTGGATT 3.453 5.12 0.040 0.060
Gm-c1028-8658 TCCAACTCCATCGTCGAG GTGAATGCGCGAAGGAT 3.564 4.2 0.055 0.010
Gm-c1028-8183 CCAAGCTGGACCATA ACATTGGCTATTTACTTACA 3.687 3.66 0.025 0.045
Gm-c1028-963 TGCCATCACTGTTTATCAAG GCCACTGCCCTGTCTTACTC 7.149 2.8 0.060 0.05
  1. Ten genes were chosen at random to have their differential expression between Clark (Fe-efficient) and IsoClark (Fe-inefficient) identified by microarray analysis confirmed by semi-quantitative real time PCR analysis. Differential expression was confirmed for nine of the ten genes chosen. In four of the nine genes the real time PCR showed greater differential expression between the NILs than was identified by microarray analysis.