Skip to main content

Table 3 Real-time PCR primer pairs

From: Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

Contig Gene sense antisense TaqMan probe RT primer
257 Cutilcle protein CGTCGCCGATGTGAAATAC AAGAAGAACCTTTGTGATAGGAATC GGATATGCCAAGTACCCCGAGT GGCATCGTATTTTGGA
262 Hemoglobin TTCAAAGCCAAACCCGAAGC TTGGCAAATCCGTAATGGACA AGAAGCTCTTTTCGGAATTCGCCAACG AGCGTTCAGGAAATCGT
221 Metallothionein AAACTACCCAACGGAATCAACAT CAGTTGGGTCCGCATTTG CCACACGAGCATTTACCTTGGCAAC  
274 STKa TTTTTAACAGAACCATCTTTGTCCAA GACATAGTTTTTCAACATTCCTTCACAG GTGTAAGTACGAGTTAAAGAAATTATCAGCCATC CTGATACACAAGGTACGATAA
  1. aSerine threonine kinase