Skip to main content

Table 4 Characteristics of genes amplified for SNP detection

From: Identification and analysis of Single Nucleotide Polymorphisms (SNPs) in the mosquito Anopheles funestus, malaria vector

Genes Chromosomal Location Accession no. Function Forward primer Reverse primer Product length No of SNPs
4G21 X AY648704 Cytochrome P450 GGCGATAGCAAACGTAAAGC CGCGGTAAACGGAATATAGC 303 2
9K1 X AY987362 Cytochrome P450 GTACGAGCTGGCCGTTAATC CCTTTCTGTAGCTGCACCTTG 243 9
4J12 3R AY648706 Cytochrome P450 CCAACAAATCAGTTCATCAGC TTGTAAAAGTGCTTAAAATG 270 9
6P9 2R: 9A-12C AY729661 Cytochrome P450 GCGCCTTAGACAAGAGATCA AAGGGATGTCGCTTCTTCTC 350 8
6P4 2R: 9A-12C AY987359 Cytochrome P450 GTACGAGACTGGCAAAGAAT AAGGAAGACGTATGGATGG 430 13
6P5 2R: 9A-12C AY987360 Cytochrome P450 CTGGCTTTGAAACTTCCTC AGATACACGTAGGGATGTCG 550 3
6Z1 2L: 25A-27D   Cytochrome P450 ACGATCCGTTCCGGGTAG GCTAGCGCAGGATACATTCG 550 12
6Z3 2L: 25A-27D   Cytochrome P450 GACGATCCGTTCCTGAAGAC ATCGGTAAGCCCGGATATTT 550 20
9J12 3L AY729663 Cytochrome P450 TACCGGTGTGCAGCTTGA CTTTGGCGCGAAGGTAAA 194 5
9J14 3L AY729665 Cytochrome P450 CGGACAACGTATGATCGATTT TTTGGCTTGCATTAAAAGGTG 214 5
BU01 X:2B BU039001 type II transforming growth factor-beta receptor GTGTGTTTGCTTGGGTGTTG GGCATCGGTAATCAGGATGT 525 1
BU08 2R:7C-10B BU038908 rhodopsin CATTTGTGGAACCCCATTTC GGTCATTGGTTTACCCGAGA 500 7
Ache 2R:9C-12C DQ534435 Acetylcholinesterase GGGTACGGGACAACATTCAC CGTTAACGTACGGGTCGAGT 1050 15
BU10 2L:28A BU039010 Cyt-c-p-P1 AAGCACAGTTAAACCTTTCG ACCTAGCCCAATCTCTGTCT 650 10
BU11 3L:43B BU038911 protein transporter ATCTGCTTGCGCTAGATCGT ATCGCCAAATTTCATCTTCG   2
BU12 2R:7B BU038912 Alpha tubilin AAGCTCGAGTTCGCCATCTA CTCCAATCCTTTCCGACGTA 800 5
BU13 2R:15C BU038913 signal sequence receptor ACCCTGAGAAATCGTAACAA CCGATAGTTGAGAGCAATGT 630 10
BU19 2R:12B BU038919 Chitinase CTGTTGCTGCTGCTACATAC CCGGTCACGTACAAATAGTC 670 10
BU021 3L:38C-40B BU039021 Tubilin beta-3 chain GAGTTGGTTGATGCCGTGTT CGTCCGGAAACAAATATCGT 400 8
BU21 X:3A BU038921 Phosphoribosylaminoimida-zole carboxylase TTTCAAGGTGAACGGTGTGA CCATCAAGATGACGACCAGA 475 11
BU25 2R 12B BU038925 ferritin heavy chain-like protein GCGTAAAGCTGTCGTCCTTC ATTCCCCCGTCAGGTAGTCT 1200 2
BU29 2L:27B BU038929 sensory appendage protein CACCAAGTACGATGGTGTCG AGGCACTTGGTTTTGCAGTT 410 6
BU34 X:1C BU038934 NADH dehydrogenase GGCAGGTAGCAGCAGTTTTC CAGTACCAACCGCAACACAC 400 6
BU35 2R 12B BU038935 CG6846 gene product TTCAGCAAACACGTTTCGTC ACTTGCCCTTGTCCTTGTTG 400 9
BU40 2R:14B BU038940 Glutathion peroxydase AGGCAAAATCAATTTTTGAA CGTAACAATTTCTCGACCAT 1150 10
BU56 2R:7B BU038956 novel An. gambiae salivary protein AATCTAGAAGCTGCGCCAGA AATTCTAGGACGGCGATTCC   13
BU58 2R:12D BU038958 translation initiation factor ACTTCCACGCCCAGTGTATC CGTGCAGAGTTCGAAAACAA 650 5
BU62 2L:23A BU038962 cAMP responsive element binding protein CAATCGGAGCGTAAGGAAAG CGTTCTCCCGCAAAAACTAA 475 13
BU66 3R:30A BU038966 Lysozyme TAGCTCATAGTGGCGGTTAT ACTACAACATGTCGTGCAAA 650 22
BU70 2R:7C BU038970 Ubiquitin fusion 80 GTGGACTCCGTACCTGGTCA CTGTAGAATTACAGGAGGGCGTA   5
BU71 3L:39A BU038971 structural protein of peritrophic membrane GGGAAGTCGGTGTAGGGAAT ACGTTTGGGTCAGGTAGTCG 750 11
BU72 2R:12B BU038972 RHO small monomeric GTPase GATGAAGCTGCCAAAGATCC TGCCTCGTCGAAAACTTCTT 900 11
BU73 2R:7A BU038873 actin binding AGTAAGAAACGAACGCAAAG CGGAAAAGTTGGAATGTAAC 430 3
BU76 2R:10B BU038976 translation initiation factor TGCCTACGAACGACGTAATG GGCTCGTAGCTGGTCACTTC 500 16
BU77 2R:10C BU038877 ubiquitin conjugating enzyme CAACACACTAGCCAGCAAGG TTTGGTTCGGCCAACATACT 408 23
BU82 2R:14D BU038882 Unknown AGGGCGGTACAACAAAATCT GCATCGGAGCGTTTCCTA 400 8
BU85 2R:12E BU038885 phosphoglycerate mutase AAAAAGAATGGCCGGAAAGT CTCATCGCCCAGAATTTCAT 800 14
BU88 2R:11B BU038988 translation initiation factor GTGGCCTCCCACTTTGTTAG TACCGGATACGGTTGACGAT 800 29
BU90 3R:35B BU038990 gustatory receptor GGGACATCATCATCATCGAC TTTCGCTTCTCGCGTTAAAT 300 3
BU92 3L:39A BU038892 Microtubule binding CATGCGACCGAAGAGAAGTT ATCCTGATTCTGGCTCATGG 550 18
BU93 2R:7C-10C BU038893 prefoldin subunit 2 CACCGGAAACTCGGCTATTA TATCGGTTCCATCCGAAAAG 550 10
BU98 3L:46B BU038898 CG7630 gene product TGCGTCACCCGTTACAAATA ACGTGTACGCTTTCCACCTC 550 15
BU883 3R:32B BU038883 peritrophin TTCGTGACACAGTTATACGC GCACACTTCAGACTTCCTGT 650 22
BU897 3R:36C BU038897 NADH dehydrogenase (ubiquinone) GGGAATTCCGTGATTTTT GGCAGAAATATCCATAATCG 700 15
BU901 2L:20C BU038901 CG18397 gene product AAAGACACTCCCGCATTACG CTCGTGTCTGTTTGGCTTGA 480 7
BU973 3R:36F BU038973 polyA-binding protein II AGTAAGAAACGAACGCAAAG CGGAAAAGTTGGAATGTAAC 630 3
BU974 3L:40A BU038974 serine-type peptidase ACTGGCGGAGAACGTACAAC TGCTGCACATTAATCAAAGGTT   4
BU982 2R:12B BU038982 ferritin 2 light chain homologue CTAGTTTCCTGTCGCGTTCC CATCGTCTCCTCCATTACCG 400 3
BU996 2R:8D BU038996 vacuolar hydrogen-transporting ATPase GTTCGCCTACATGTGCTTCA ACAAAGGGTGTGCAAAAAGG 800 21
Kdr 3R: 36A-37E DQ534436 Sodium channel gene TGCAAAATAGAGTCATTGGTGAA ATCATCTTCATCTTTGC 1342 9
\