Skip to main content

Table 1 PCR primers used in study.

From: Growth of the protozoan parasite Entamoeba histolytica in 5-azacytidine has limited effects on parasite gene expression

(A) Primers used in RT-PCR
Probe set Primer name Direction AT Primer sequence (5' – 3') Target region
115.m00143_at 115.m00143F S 55°C CCAAACGATACACACCCAGA Coding
  115.m00143R AS 55°C GCAATTTGAAACTTCACATCACA Coding
141.m00082_at 141.m00082F S 55°C TCATTTGGAATTGTTTATGTTGG Coding
  141.m00082R AS 55°C TGCACTTCCAAAATCCGTTA Coding
2.m00545_at 2.m00545F S 55°C GCTGCCATGACTAATGCTGA Coding
  2.m00545R AS 55°C AGCAACAGCAACTGGTCCTT Coding
226.m00092_at 226.m00092F S 55°C GCAAACATGGGATACAGCAG Coding
  226.m00092R AS 55°C ACAAGGCGCTTGTTCAACTT Coding
(B) Primers used in PCR from bisulfite treated DNA
Probe set Primer name Direction AT Primer sequence (5' – 3') Target region
64.m00187_s_at EHsp5'bis* S 50°C ATGAATAAGAAAGTGTGAATAATAG Promoter
  EHsp3'bis* AS 50°C AACATTAATTCCACTATTTCCTACTA Promoter
  EHsp1005'* S 50°C TGAGTATTTAAAGGAACTTGAAG Coding
  EHsp3'bis* AS 50°C AACATTAATTCCACTATTTCCTACTA Coding
115.m00143_at 115.mPF S 52°C CTTGAAGGATAAAAAATAAGTCATATTTCTA Promoter
  115.mPR AS 52°C ATAATCTGCATGGCATATATTTCCTAATT Promoter
115.m00143_at 115.mBCF S 48°C ATGTTTGTATCTTATTTTCTATTTTTAATTT Coding
  115.mCR AS 48°C GTTCCAGTACATACAATTTTACCT Coding
141.m00082_at 141.mBPF S 52°C TATTGAACACTGCTCTAAATCCACT Promoter
  141.mBPR AS 52°C GTGTAGTACTGAATAAACACTTTTCTT Promoter
  141.mBCF S 53°C TTGATATAACTAATTCACCTACATTCCAA Coding
  141.mBCR AS 53°C GATCCTTCTCCTATTTTCTTTTCTTCT Coding
97.m00140_at 97.mPF S 50°C ATTACTCCTTCCCTCTCTTCTT Promoter
  97.mPR AS 50°C CCATTRTCATTTCTCTCAACC Promoter
194.m00103_at 194.mPF S 50°C GACTRCACCCAATTTTCCACCT Promoter
  194.mPR AS 50°C CCATCCCAATAAATTCCTTCTT Promoter
687.m00016_at 687.mBPF S 53°C CTTTCARACACTTAACAAATCTTCTTCA Promoter
  687.mBPR AS 53°C ARATTCTCTCAAATACACTTCCCAC Promoter
3.m00674_at 3.mBPF S 49°C GTTATTCAATTATACTTTATACCAAACA Promoter
  3.mBPR AS 49°C TCATTTTARTTCTTTTTTCTTATACCACT Promoter
160.m00098_at 160.mBPF S 50°C CTAATAAAATTTTCTTACACCTAACTCA Promoter
  160.mBPR AS 50°C CTTCTTTATTTTTTCCATAATATTCTTTCT Promoter
26.m00304_at 26.mBPF S 48°C TAAAACTARACCATTTATTCAACAATT Promoter
  26.mBPR AS 48°C RRTTCTTCTTCCATAATTTATTATTA Promoter
2.m00545_at 2.mBPF S 50°C TTACTTCTCGTTATTCTATTAATATAAAC Promoter
  2.mBPR AS 50°C GATTATTTTTTGCCATCCATTTATCAA Promoter
  2.mBCF S 50°C CTAAATTTACAAAAAAACTAATATACTCTC Coding
  2.mBCR AS 50°C TAGAGCCACCATTACATCCATTA Coding
226.m00092_at 226.mBPF S 49°C CTATTGATATTGAAATGCAAAAAACAAT Promoter
  226.mBPR AS 49°C TGATATATCAACTTAAACAAACTTACTA Promoter
  226.mBCF S 50°C GTTCTTCTAGATTATTAAAAACCATTC Coding
  226.mBCR AS 50°C AACACTTCCTTTATCTATTTTATTTCC Coding
  1. Primers used, annealing temperatures, sequences, and their targets (gene promoters or coding regions) are listed for the (A) RT-PCR and (B) bisulfite sequencing studies. The probe set targeted, the primer name, direction of the primer, annealing temperature, primer sequence, and region of each gene targeted (coding or promoter) are shown. S refers to the sense primer; AS to the antisense primer; R represents either A or G. * indicates primers taken from Bernes, et al., 2005 [16].
\