Skip to main content

Advertisement

Table 4 Oligonucleotide primers used for microarray results validation with qRT-PCR

From: Transcriptional profiling of Actinobacillus pleuropneumoniae under iron-restricted conditions

# Gene Forward Primer Reverse Primer
  ackA CCTAAAACGGGTGACGAGAA ACCGATAGCACCGATACTGG
1 ap1465 CGTAGCGCGTTCCGAATTAA AACTGCCGTATTTGTCGTGC
2 apxIC TGGTTATGGGCAAGTTCTCC CAACTAGCGAGGCAACATCA
3 ccmC ATACGGTTCTATGGCGGTTG AAACAACACCAAAGCCGAAG
4 dcuB2 GGCTTTGAAGGCGTTACACT GCCGGTAATTGCTCGTCTAA
5 dmsA AACTGTGGTAGCCGTTGTCC AATGCGGCAAACTGATAACG
  exbB1 CCGTTCATTGGGTTATTTGG ACGGTTAAGGCGAGCAATTA
  exbD1 GGGCATTTATTTAGGCGAGA TGAGTCACAAAGCCTATTTTCG
6 fetB2 CCGCTCTTGATATTCCGATG TTCCAAGCGTTTGTTTGATG
7 hgbA TGAATTTCGGGCAATTATGG TCCGCTTTCTTCGCACTTAC
8 NMB1668 AAACGGATTTCGGCATACAC CGTACCGGAGAACATTTCGT
9 nrfA AAGAAAAACCGGCTCAAACA ATAACCCGCCCATAACACAA
10 nrfC GCACCCGTAGAGACTTCGTC GCCTTCCGGTACTTTGTTTG
11 nrfE CCGTTTGAGCGTAGTTTTCC ATTGTCCAAGGTCGAATCCA
12 omp64 GCGGACAGTAAGCCTGAAAC TGTTGTCGCATTTGAACCAC
13 ompW GGCGAAGTGGCAAAAGTAAA CAACACCTAAATTCGCATCG
14 pepD GGCGCAAAAGTAGCATTCTC TTGTCGGTCCGATAGAAACC
15 PM0741 GGCTCGGATTCATTTACCAC AATAGACCGCATCCAGCTTC
  tbpA ATTGGCAACCATCGGATTTA GCACCTAAGCGATCACGAGT
16 tonB1 CTCCCTTGGTGCTGGTTATG AATTTTTGCCGGTTGATACG
17 torA GAATTTCCTTGTGCCGAGAG GCTTCGCCGTATACCAAGTC