Skip to main content

Advertisement

Table 6 Primer sequences used for RT-PCR

From: Annotated ESTs from various tissues of the brown planthopper Nilaparvata lugens: A genomic resource for studying agricultural pests

Representative clone   Primer sequence Product size (bp)
Highly expressed in BPH
MB3851 forward GGCGTGTTGGTGTTGCTTCA 515
  reverse GCTTAGCAAATCCTGGGACA  
Female gonad-specifically expressed
AB0551 forward AATCATCGCTGCTTTCCTCGCC 437
  reverse GGGAGCAAGGAGAGGCTATTAC  
OB0570 forward GGGACACAGACTTAACTTGGCG 505
  reverse AGCAACTCTTGCTCCATAGT  
OB0998 forward TCCCAAAGTCGATGGCCGAATC 529
  reverse TGGTACTGACTGATCGTTCC  
OB1013 forward GACGGAGCAACCGTACATAT 486
  reverse CGGTGAAGTAGATGGTCTCA  
OB1061 forward CATCAGCCCTGTGACGATAGAG 602
  reverse TCTGCACTCGCTGCTGTTCCAT  
OC0606 forward CTGTGATCTCAAGCTCAGCCTG 498
  reverse CACCAGCATGACCTTGGAGTAC  
OC0638 forward GTCTGTGCCCTTTGCGCCAT 504
  reverse GCATGGCTGATGGCAGACTG  
OC0681 forward GTAAAATGGCCGCCAAGTCACT 435
  reverse GAATGGAGAGGTGTGTTGCA  
OC1014 forward CGTTGTTGCTGCCTTGGCACTA 480
  reverse CCTGGATTTGCCTAAGCTGCAA  
OC1083 forward CATCCTGTGGATGCGGATACTC 512
  reverse GACTAGTAAAGCACAGATCG  
OC2756 forward AGTGATCACAAGCTCTGCCTG 382
  reverse TATGCCACACAGCCAACACCAG  
Male gonad-specifically expressed
AC0657 forward CGAGCTCTGTGTTGCTGAAG 575
  reverse CAGCAGGAGTTAAAACATGGG  
AC0743 forward CACCAACTCAACACTCCAC 525
  reverse TTACTTCGGCCACACGGCTC  
AC0825 forward GCGACTGGTGCAAAGTAGCA 610
  reverse TCTTGACTCAGCTTCCCATC  
AD1216 forward CTTCATTGTGGCTGTTGCAAG 444
  reverse TCAGGGTATAGTGACCTTCC  
NB2328 forward CCTCAGTACACAGTGAAACTC 480
  reverse GCTCTTCACAGGGATCCACA  
NB3697 forward GGCAGAATCAGTCGAAGATC 435
  reverse GCGCCACATTTTGGAATGGG  
NB5623 forward AGAACCAAACCCAAACAGGC 416
  reverse GTTACACGGATACAAACCCTG  
TA0293 forward ACCATGCAGCAGAGGGAATC 542
  reverse GGATGGGTGACCATGGAGTC  
TA0428 forward CCATCTCCTGAAACTGTAGG 464
  reverse AGGCAGTTCAAGTGGCTCTC  
TA0528 forward CCAAAACTCCTACGGTACCG 502
  reverse TTTTTCGCAGGGGTCGGTGC  
TA0721 forward CACTCATCTCCAGTGATACC 452
  reverse CTGGTGCTAATGTTGGAGCG  
TA1050 forward TCATTTTCCCGATGGCAAGC 527
  reverse TTTCGACGGCACGCTTCTCC  
TA1095 forward CCAGAGATCCTGCAGAGACA 545
  reverse GCCTTAGTGTAACACTATTCCC  
Control PCR primer for template validation
NL_EF2 forward GAAGTTCAGTGTGTCGCCTG 420
  reverse TCTCCCAGATATCTGGCTCT