Skip to main content

Table 7 Sequence of primers for qRT-PCR.

From: Transcriptomic analysis of the dialogue between Pseudorabies virus and porcine epithelial cells during infection

Target Oligo Sequence Size(bp)
RPL32 forward TGCTCTCAGACCCCTTGTGAAG 22
  reverse TTTCCGCCAGTTCCGCTTA 19
SLAIa forward CATCATTGTTGGCCTGGTTC 20
  reverse CCTTTTTCACCTGAGCGC 18
TAP1 forward CCAGTATCTCAGGGATGTTGCTG 23
  reverse CGCTGCTTATAGCCCCACC 19
TAP2 forward TGTTGGGTGAGACACTAATCCCTTA 25
  reverse CAAAGGCATCAGGGTCAAAATC 22
PSMB9 forward GCGCTTCACCACAAATGCTA 20
  reverse TCCACACCAGCAGCTGTAATG 21
PSMB8 forward TACCTGCTTGGCACCATGTCT 21
  reverse AGTACAACCTGCACTCCTTGGC 22
PPIA forward GTCTCCTTCGAGCTGTTTGCA 21
  reverse CCAAATCCTTTCTCCCCAGTG 21
TNF forward CCCAAGGACTCAGATCATCGTC 22
  reverse AGCTGTCCCTCGGCTTTGA 19