Table 3 Novel miRNAs
miRNA name (cluster name) | mature sequence of novel miRNA | reads | Predicted precursor of novel miRNA location / comments |
|---|---|---|---|
hsa-mir-1469 (srclusterF2762) | CUCGGCGCGGGGCGCGGGCUCC | 1 | chr15:94,677,494-94,677,540 (+) / intron of NR2F2 |
hsa-mir-1251 (srclusterF3130) | ACUCUAGCUGCCAAAGGCGCUU | 1 | chr12:96,388,159-96,388,215 (+) / intron of RMST |
hsa-mir-1470 (srclusterF891) | GCCCUCCGCCCGUGCACCCCG | 1 | chr19:15,421,359-15,421,419 (+) / antisense intron of WIZ |
hsa-mir-675b (srclusterR1978) | CUGUAUGCCCUCACCGCUCAG | 3 | chr11:1974572-1974628 (-) / star sequence of miR-675 |
hsa-mir-1471 (srclusterR2035) | GCCCGCGUGUGGAGCCAGGUGU | 1 | chr2:232,582,457-232,582,513 (-) / intergenic |
hsa-mir-1468 (srclusterR3487) | CUCCGUUUGCCUGUUUCGCUG | 1 | chrX:62,788,915-62,788,976 (-) / intergenic |