Skip to main content

Table 2 Primer sets used for Quantitative real time PCR analysis

From: Transcriptional regulation by Poly(ADP-ribose) polymerase-1 during T cell activation

Gene Forward primer Reverse primer
Egr-2 GCCAAGGCCGTAGACAAAATC CCACTCCGTTCATCTGGTCA
Nr4a1 TGAGACCCTATCCTCCAGCG TCTGGCTCGGGGAGAAGTG
Prnp ATGGCGAACCTTGGCTACTG CCTGAGGTGGGTAACGGTTG
Il12rb1 ATGGCTGCTGCGTTGAGAA AGCACTCATAGTCTGTCTTGGA
Il-4 GGTCTCAACCCCCAGCTAGT GCCGATGATCTCTCTCAAGTGAT
Ccl4 TTCCTGCTGTTTCTCTTACACCT CTGTCTGCCTCTTTTGGTCAG
Rel CAGAATTTGGACCAGAACGCA TGCTGTTCACCCACATTGAAAG
Slamf1 CAGAAATCAGGGCCTCAAGAG CACTGGCATAAACTGTGGTGG
Gbp7 TCCTGTGTGCCTAGTGGAAAA CAAGCGGTTCATCAAGTAGGAT
Ccl9 CCCTCTCCTTCCTCATTCTTACA AGTCTTGAAAGCCCATGTGAAA