Skip to main content

Table 2 Relative abundance of differentially expressed microRNAs

From: Deep Sequencing of Chicken microRNAs

microRNA name Length Sequence # Reads in MDV infected CEF # Reads in uninfected CEF Ratio Infected/Uninfected (Normalized)
gga-miR-29b 23 TAGCACCATTTGAAATCAGTGTT 64 2 18.8
gga-miR-196 21 TAGGTAGTTTCATGTTGTTGG 23 1 13.5
gga-miR-133a 22 TTGGTCCCCTTCAACCAGCTGT 15 2 4.4
gga-miR-10b 22 TACCCTGTAGAACCGAATTTGT 70 15 2.7
gga-miR-30d 22 TGTAAACATCCCCGACTGGAAG 23 6 2.3
gga-let-7f 22 TGAGGTAGTAGATTGTATAGTT 338 454 0.4
gga-let-7b 22 TGAGGTAGTAGGTTGTGTGGTT 74 105 0.4
gga-miR-130a 22 CAGTGCAATATTAAAAGGGCAT 18 28 0.4
gga-let-7a 22 TGAGGTAGTAGGTTGTATAGTT 383 603 0.4
gga-miR-1a 21 TGGAATGTAAAGAAGTATGTA 7 12 0.3
  1. Data shown are microRNAs with more than 15 reads in one library and 2-fold difference in read count, after scaling for total number of reads matching the chicken genome in each library.