Skip to main content

Table 1 Top 10 structures from the "highly conserved set" based on structure conservation.

From: Mining small RNA structure elements in untranslated regions of human and mouse mRNAs using structure-based alignment

Group ID1 (CoV2) Structure3
GO Entries4
3 (HSL3)
(28.13)
NM_005321:721-785
NM_021062:401–431
NM_005319:704–732
NM_003526:412–438
NM_002105:545–578
NM_003516:510–534
#=GC SS_cons
AACC-C-AAAGGCTCTTTTCAGAGCCACCCA
AACC-C-AAAGGCTCTTTTCAGAGCCACCTA
AACC-CAAAAGGCTCTTTTCAGAGCCACC-A
--CC-C-AAAGGCTCTTTTAAGAGCCACCCA
A-CCAC-AAAGGCCCTTTTAAGGGCCACC-A
-A-----AAAGGCTCTTTTCAGAGCCACCCA
..........((((((....)))))).....
HIST1H1E: histone cluster 1, H1e
HIST1H2BB: histone cluster 1, H2bb
HIST1H1C: histone cluster 1, H1c
HIST1H2BC: histone cluster 1, H2bc
H2AFX: H2A histone family, member X
HIST2H2AA3: histone cluster 2, H2aa3
GO:0006334 (0) nucleosome assembly
GO:0007001 (0) chromosome organization and biogenesis (sensu Eukarya).
9 (IRE)
(19.93)
NM_003234:3430–3460
NM_014585:197–237
NM_003234:3884–3912
NM_003234:3481–3509
NM_000032:13–36
NM_000146:20–40
#=GC SS_cons
TTTATCAGTGACAGAGTTCACTATAAA
AACTTCAGCTACAGTGTTAGCTAAGTT
ATTATCGGGAGCAGTGTCTTCCATAAT
ATTATCGGAAGCAGTGCCTTCCATAAT
GT--TCGTCCTCAGTGCAGGGCA--AC
TG---CTTCAACAGTGTTTGGA---CG
(((((.(((((......))))))))))
TFRC: transferrin receptor (p90, CD71)
SLC40A1: solute carrier family 40 (iron-regulated...
TFRC: transferrin receptor (p90, CD71)
TFRC: transferrin receptor (p90, CD71)
ALAS2: aminolevulinate, delta-, synthase 2 (side...
FTL: ferritin, light polypeptide
GO:0006826 (0) iron ion transport
GO:0006879 (0) iron ion homeostasis
15
(17.40)
NM_015556:203–223
NM_018947:5349–5370
NM_000617:2349–2372
NM_018970:469–543
NM_173494:843–866
#=GC SS_cons
TCATTTAACCTTTTAAATGA
AAATTTAACATTTTAAATTT
TAATTTCTCAGTGGAAGTTA
TATATTTTCAGTAAAATGTA
TATTGTGACCATTTACAGTA
((((((((....))))))))
SIPA1L1: signal-induced proliferation-associated 1 like...
CYCS: cytochrome c, somatic, nuclear gene encoding
SLC11A2: solute carrier family 11 (proton-coupled dival...
GPR85: G protein-coupled receptor 85
CXorf41: chromosome X open reading frame 41
GO:0006810 (0.012265) transport
17
(17.33)
NM_004441:3717–3813
NM_004443:3616–3640
NM_005398:2077–2107
NM_032827:2394–2416
#=GC SS_cons
TCTTCATATTGAAGA
TCTTCATATTGAAGA
CCTTCATATTGAAGG
GCTTCAAATTGAAGT
(((((.....)))))
EPHB1: EPH receptor B1
EPHB3: EPH receptor B3
PPP1R3C: protein phosphatase 1, regulatory (inhibitor) subu...
ATOH8: atonal homolog 8 (Drosophila)
GO:0007169 (0.00033) transmembrane receptor protein tyrosine kinase signaling pathway
GO:0007165 (0.031793) signal transduction
GO:0006468 (0.00927) protein amino acid phosphorylation
19
(17.17)
NM_000314:502–530
NM_032564:144–170
NM_014751:110–164
NM_016233:2056–2074
#=GC SS_cons
CCTCCCGCTCCTGGAGCGGGGGG
GCCCTGGCCCCGGGGGCCGGGGC
-CGCTGGC-CCCGG-GTCAGCG-
-CCTGTCC-CCCTG-GGGCGGG-
((((((((((...))))))))))
PTEN: phosphatase and tensin homolog (mutated in multi...
DGAT2: diacylglycerol O-acyltransferase homolog 2 (mou...
MTSS1: metastasis suppressor 1
PADI3: peptidyl arginine deiminase, type III
GO:0045786 (0.00108) negative regulation of cell cycle GO:0007049 (0.009836) cell cycle GO:0006629 (0.001806) lipid metabolism
21
(17.00)
NM_000899:1060–1087
NM_015355:3606–3643
NM_003081:1331–1430
NM_002893:1613–1645
#=GC SS_cons
TTGCTTCATAAATGAAGCAG
ATTCTTTATTTATAAAGGAT
-TTATGCATTTATGCATGA-
--GCTTGATTTATCAAGC--
((((((((....))))))))
KITLG: KIT ligand
SUZ12: suppressor of zeste 12 homolog (Drosophila)
SNAP25: synaptosomal-associated protein, 25 kDa
RBBP7: retinoblastoma binding protein 7
GO:0016568 (0.000785) chromatin modification
GO:0008283 (0.002712) cell proliferation
23
(16.90)
NM_001546:1287–1309
NM_020834:2941–2962
NM_005643:1316–1339
NM_017617:8938–8965
NM_016120:2737–2778
#=GC SS_cons
CATCTATTGTTTAAAATAGATG
CAGGTTTGGTTTTACAAACCTG
CTTTAATGGTTTCACATTGAAG
G-GATTTTGTTTAAAAAATC-T
C--ATTT-GTTTAA-AAAT--G
((((((((......))))))))
ID4: inhibitor of DNA binding 4, dominant negative ...
KIAA1443: KIAA1443
TAF11: TAF11 RNA polymerase II, TATA box binding pr...
NOTCH1: Notch homolog 1, translocation-associated (...
RNF12: ring finger protein 12
GO:0016568 (0.000785) chromatin modification
GO:0008283 (0.002712) cell proliferation
25
(16.80)
NM_004625:1678–1700
NM_015508:3801–3828
NM_031371:4664–4722
NM_016513:2522–2555
NM_004744:2276–2294
NM_138290:1864–1884
#=GC SS_cons
ATATTAATTTATTTAATTAAA
ATATTTATTTTTTTAATAAAA
ATATTAAAGATTCTCTTTAAA
---TTAAAGTTTTTTTTTAA-
---TTAATTTTTCAAATTAA-
---GTAAATGTTTAATTTAC-
...((((((.....)))))).
WNT7A: wingless-type MMTV integration site family, me...
TIPARP: TCDD-inducible poly(ADP-ribose) polymerase
ARID4B: AT rich interactive domain 4B (RBP1-like), tr...
ICK: intestinal cell (MAK-like) kinase, transcript va...
LRAT: lecithin retinol acyltransferase (phosphatidylc...
RPIB9: Rap2-binding protein 9
GO:0007275 (0.036763) development
27
(16.57)
NM_000252:3053–3080
NM_003582:2041–2075
NM_001635:2828–2849
NM_001338:2060–2081
NM_152267:3108–3127
NM_006329:2418–2435
NM_005627:1871–1929
NM_000170:3730–3747
#=GC SS_cons
TTTTACAATGATTTGTAAAG
TTTTTATATGATTATAAAAG
GTTTTGCCTAATGGCAAAAC
ATTTTTCTTATTAGAAAAAT
ATTTTCACTGTTGTGAAAGT
-TTTTGAGTATTTTTAAAA-
-TCTTCCATATTTGGAAGA-
-TTATTAGTATTCTAATAA-
((((((((....))))))))
MTM1: myotubular myopathy 1
DYRK3: dual-specificity tyrosine-(Y)-phosphorylation r...
AMPH: amphiphysin (Stiff-Man syndrome with breast canc...
CXADR: coxsackie virus and adenovirus receptor
FLJ38628: hypothetical protein FLJ38628
FBLN5: fibulin 5
SGK: serum/glucocorticoid regulated kinase
GLDC: glycine dehydrogenase (decarboxylating; glycine ...
GO:0007155 (0.027609) cell adhesion
29
(16.30)
NM_002025:8958–8980
NM_014506:1434–1458
NM_014417:1285–1350
NM_007011:2104–2126
NM_004215:1327–1350
#=GC SS_cons
GCTGATGCTTTCAGC
GCTGTTCTTTGCAGC
-CTCCTCCTGGGAG-
-CTCTTCCTGGGAG-
-CTAGTGTTTCTAG-
(((((.....)))))
AFF2: AF4/FMR2 family, member 2
TOR1B: torsin family 1, member B (torsin B)
BBC3: BCL2 binding component 3
ABHD2: abhydrolase domain containing 2
EBAG9: estrogen receptor binding site associated, antigen, 9...
GO:0006915 (0.011186) apoptosis
  1. 1 Group ID is a serial number, which can be used to query the GLEAN-UTR database.
  2. 2CoV, cohesive value, which reflects the conservation of structure.
  3. 3Structures are aligned, and a consensus structure is shown for each group. For each structure, its location in RefSeq sequence is indicated, and its gene symbol and name are also listed.
  4. 4Significant GO terms associated with each structure group are shown and p-values from hypergeometric tests are indicated in parenthesis.