Skip to main content

Table 3 Primer sequences that define fragments amplified by PCR and used as hybridization probes.

From: The abundant extrachromosomal DNA content of the Spiroplasma citri GII3-3X genome

Primers Nucleotide sequence (5'-3') Accession no. Probe's name
ScARP-2a-F AAATATTAGTGGTGATATTTATAGAA AJ969072 2a
ScARP-2a-R TTATAGATTCTATGTCATCGC AJ969072  
ScARP-2b-F CAATATTAGTGGTTCTATTTATATAA AJ969073 2b
ScARP-2b-R CTGCAAGGGAATTTATTTGTG AJ969073  
ScARP-3a-F TTTTATACCAAAGGATATTGTTTCTT AJ969069 3a
ScARP-3a-R TGCAAGAGATTTAACATCTA AJ969069  
ScARP-3b-F CGGAGTTAATGATAAAGTTCAATCAA AJ969073 3b
ScARP-3b-R TACAAGCGAGTTTATTTGCC AJ969073  
ScARP-3c-F CGGAGTTAGTGATAAAGTTAATGCAA AJ969071 3c
ScARP-3c-R AGTTATTGAAATAATATCAC AJ969071  
ScARP-3d-F GGGATAAGTAATAATGCTTATTCAC AJ969070 3d
ScARP-3d-R CAAAAACTAGGTAATTAACATTAAC AJ969070  
ScARP-4a-F CTAAAAAAGATGTTACAACTGG AJ969072 4a
ScARP-4a-R ACGCATTCCAGCGTTAGACC AJ969072  
ScARP-5a-F AAATATTAATGTCTCTTCTTTAAAAA AJ969073 5a
ScARP-5a-R CACAAAGACACCATTACTTG AJ969073  
32F1- TAACGAATTAAATCATTCTAATAGC AJ969074 p32
32R TAGTTCCGGCTTGCTCACCA AJ969074  
Rep-F GCTAATAAATTAACTCGCAA AJ969070 U
Rep-R TTTTCCATTTTTAACTCCCGC AJ969070  
pSciA-F CCAAAAATCTAGGGCGACGA AJ967634 A
PSciA-R TATTGAATTGTCCCACTGCT AJ967634