miRNA1 | miRBase Name3 | Sequence4 | Occurrence5 | Location6 | Score7 |
|---|
ast-let-7 (Ia) | ast-let-7 | UGAGGUAGUUGGUUGUAUAGU | 12 | 3R, 10270763 (-) | 14.8 |
ast-miR-124 (Ia) | ast-miR-124 | UAAGGCACGCGGUGAAUGC | 1 | 3R, 29002032 (+) | 11.32 |
ast-miR-14 (Ia) | ast-miR-14 | UCAGUCUUUUUCUCUCUCCUA | 38 | 3R, 24898098 (+) | 16.9 |
ast-miR-210 (Ia) | ast-miR-210 | UUGUGCGUGUGACAACGGCUA | 7 | X, 21450383 (+) | 12.72 |
ast-miR-276 (Ia) | ast-miR-276-5p | AGCGAGGUAUAGAGUUCCUA | 4 | 2L, 18991766 (+) | 15.96 |
ast-miR-277 (Ia) | ast-miR-277 | UAAAUGCACUAUCUGGUACGA | 4 | 2R, 28234532 (-) | 15.78 |
ast-miR-277* 2 (Ia) | Â | CGUGUCAGAGGUGCAUUUA | 1 | 2R, 28234583 (-) | 15.78 |
ast-miR-281 (Ia) | ast-miR-281 | UGUCAUGGAAUUGCUCUCUUUA | 24 | 2L, 17362444 (-) | 16.14 |
ast-miR-283 (Ia) | ast-miR-283 | AAAUAUCAGCUGGUAAUUCU | 1 | 2R, 37890092 (-) | 14.92 |
ast-miR-317 (Ia) | ast-miR-317 | UGAACACAUCUGGUGGUAUCU | 10 | 2R, 28252007 (-) | 10.57 |
ast-miR-8 (Ia) | ast-miR-8 | UAAUACUGUCAGGUAAAGAUGU | 13 | 3L, 38943098 (+) | 14.73 |
ast-miR-8* 2 (Ia) | Â | CAUCUUACCGGGCAGCAUUA | 1 | 3L, 38943058 (+) | 14.73 |
ast-miR-9a (Ia) | ast-miR-9a | UCUUUGGUUAUCUAGCUGUAU | 3 | 2L, 15089338 (-) | 13.6 |
ast-miR-11 (Ib) | ast-miR-11 | CAUCACAGUCUGAGUUCUUGCU | 1 | 2R, 13042084 (-) | 14.97 |
ast-miR-276a (Ib) | ast-miR-276-3p | UAGGAACUUCAUACCGUGCUCU | 2 | 2L, 18991809 (+) | 14.72 |
ast-miR-34 (Ib) | ast-miR-34 | UGGCAGUGUGGUUAGCUGGUU | 5 | 2R, 28232720 (-) | 17.77 7 |
ast-miR-87 (Ib) | ast-miR-87 | GGUGAGCAAAUAUUCAGGUGU | 1 | X, 261196 (-) | 12.12 |
ast-miR-12 (IIa) | ast-miR-12 | UGAGUAUUACAUCAGGUACUGGU | 2 | 2R, 37888125 (-) | 8.45 |
ast-miR-375 (IIa) | ast-miR-375 | UUUGUUCGUUUGGCUCGAGUUA | 1 | 3R, 51640581 (-) | 10.44 |
ast-miR-2a (IIa) | ast-miR-2-1 | UAUCACAGCCAGCUUUGAUGAG | 2 | 2L, 37757111 (-) | 15.99 |
ast-miR-304 (IIb) | ast-miR-1889 | ACACAUUACAGAUUGGGAUUA | 2 | 2R, 37888805 (-) | NS 8 |
ast-miR-306 (IIb) | ast-miR-306 | UCAGGUACUGGAUGACUCU | 1 | 3R, 5888649 (-) | 7.53 8 |
ast-miR-76 (IIb) | ast-miR-981 | UUCGUUGUCGACGAAACCUG | 2 | X, 1228349 (+) | 12.73 |
ast-miR-x1 (IIc) | ast-miR-996 | UGACUAGAUUACAUGCUCGU | 1 | 2R, 55572846 (-) | 16.19 |
ast-miR-x2 (IIc) | ast-miR-989 | AUGUGAUGUGACGUAGUGGUA | 6 | 3L, 2905484 (+) | 15.15 |
ast-miR-x3 (IIc) | ast-miR-1890 | UGAAAUCUUUGAUUAGGUCU | 1 | 3R, 21181098 (-) | 17.45 |
ast-miR-x4 (IIc) | ast-miR-1891 | UGAGGAGUUAAUUUGCGUGUUUU | 2 | 3R, 5819094 (-) | 14.40 |
- 1. The names for these An. stephensi miRNAs are temporarily assigned according to similarity to known miRNAs. Formal name assignment will be made after miRBase submission. ast stands for An. stephensi. An. stephensi miRNAs shown here are divided into two main categories. Category I includes miRNAs that match An. gambiae miRNA predictions that were previously reported in miRBase (category Ia) or [23], category Ib). Category II are miRNAs that have not been reported in An. gambiae or any other mosquito species. This category includes miRNAs that displayed perfect or near-perfect (1 nucleotide mismatch only) match to miRNAs from non-mosquito species in miRBase (category IIa), miRNAs that displayed 80% or higher overall similarity to miRNAs from non-mosquito species in the miRBase (category IIb), as well as miRNAs that showed no match to any miRNAs in miRBase at the default e-value cutoff of 10 (category IIc). miRNAs in category IIc are temporarily labeled with an "x" in front of an Arabic numeral.
- 2. A "*" delineates that the sequence matches the miRNA* strand of miRNA:miRNA* heteroduplex.
- 3. These are formal names assigned by miRBase, which were received during the proofing stage. See the last paragraph of the Discussion section for details.
- 4. The longest sequence of each miRNA is shown. Variants with different ends are shown in Additional file 1. The observation of end variants has literary precedence (see [32]).
- 5. Occurrence refers to the number of times a sequence appeared during our cloning and sequencing.
- 6. Location refers to the location of match in the An. gambiae genome as there is no An. stephensi genome assembly available. The location is indicated by chromosome name, start position of the mature miRNA, and strand orientation. All matches are 100%.
- 7. Score refers to the result of miRscan analysis. Unless otherwise noted, the pre-miRNA sequences used for miRscan are pairs from An. gambiae and Ae. aegypti. In the original miRscan paper [29], most of the validated C. elegans miRNAs received scores of 9 or above although a small number of them received scores significantly less and some even received negative scores.
- 8. The precursor sequence of Ae. aegypti miR-34 contains a large segment in the loop region, which may be the cause for no score or "NS" by miRscan for the An. gambiae and Ae. aegypti pre-miR-34 alignment. Thus An. gambiae and D. melanogaster pre-miR-34 alignment was used for miRscan, which produced a score of 17.99.
- 9. We could not find homologs for miR-304 and miR-306 in Ae. aegypti. Homologs were found in D. melanogaster (see Figure 3), which were used for miRscan analysis shown here.
