Skip to main content

Advertisement

Table 1 PCR Primers used throughout this work

From: The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome

Purpose Target region Primer name Sequence (5' → 3')
Determination of the are of deletion ORF 1 rgx1startfw TAAGTTTAGCTAAGGCAGAG
   rgx1startrv AAATTAAAGAGGCTAGGCTG
  ORF 3 rgx1orf3fw ACTCGTATGCTTGACTTTCTG
   rgx1orf3rv CTATCTTGTTTAACCCAGTCAC
  ORF 4 rgx1orf4fw CTCTTTACTCAATCGCCGAC
   rgx1orf4rv CCAACAGCAGATTACGAGAC
  ORF 5 rgx1orf5fw CTTATCCATTTCCGTGTTCC
   rgx1orf5rv CTAGAATTCAAAGTCGCCAG
  ORF 10 rgx1orf10fw TATAAGTCTGTTTGGTCCCTG
   rgx1orf10rv GTATTACTCACGCTTTACCTG
  ORF 14 rgx1orf14fw TAATAACCCAACCTCTACAC
   rgx1orf14rv ACACGAGCAGAATATTAGTC
  ORF 15 rgx1orf15fw GTACTCTAGAGACAGAATGGTGGCGCTATCGTC
   rgx1orf15rv GTCAGGATCCAGAGCGGTATCAAGCAGTATCC
  ORF 16 rgx1orf16fw ATGTCTACCTTACTGGATACTG
   rgx1orf16rv CCGTCACATATTACAAGTTCTG
  ORF 20 rgx1orf20fw ATCCACCTCATCGTTATTCC
   rgx1orf20rv GTGGTTAAGAACAATGGAGC
  ORF 26 rgx1orf26fw GTTGACACCATCTACTGCTG
   rgx1orf26rv GCTTATCTACGCCGATTCTG
  ORF 28 rgx1orf28fw GTGTTTAACCATAGCCAGAC
   rgx1orf28rv TCTAGGTAAGCCTTCAAGAG
  ORF 29 rgx1orf29fw GAACTCCCTAACTTCATCTCAG
   rgx1orf29rv CAACCATCTCACTAGACCAC
  ORF 31 rgx1orf31fw TTCTTGTCAACCCAACAGTC
   rgx1orf31rv TTTCTACCACCTTTGAGCAG
  ORF 34 rgx1orf34fw GATACGGTAGATATTCTTCC
   rgx1orf34rv GAGAGTACATTCTAACTACC
Determination of the downstream end of the deletion +500 orf31do05kFw GAGGTACAGCGAATACAC
  +1000 orf31do1kFw CAGATGGTGTTCAAGTTCTC
  +1500 orf31do15kFw CTCTTGCTTCCATCAAATCAG
  +2000 orf31do2kFw CGTCAAGTGTTATGTTGTCC
  +2500 orf31do25kFw CGAGATGAAAGATTCACAGC
  +3000 orf31do3kFw GAGGTATCGTGTTCAATGTC
Genome Walking   GWqm9414gsp1 CCTTATCACTACCTTCCACCTCCATCTTATACCC
   GWqm9414gsp2 CCTCCATCTTATACCCTCTACCCAATTCCC
   GWRUTC30gsp1 TACCGCCATCGCAGACTGTTCCCTTTC
   GWRUTC30gsp2 TCACTATGAGACGGCAG
Cre1 amplification   Cre1fw TCTCTGGGCTCTCTTGTAACC
   CreIIr TGCCACTCCTCCTCATGTCAT
   creF GTACTTTGGCCCTCGCTGAG
   creR CCAGACTGCATAAGGATTCCC
   creRUTr AGCAATCAGGTGCAGATATCAC