Skip to main content

Table 1 PCR Primers used throughout this work

From: The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome

Purpose Target region Primer name Sequence (5' → 3')
Determination of the are of deletion ORF 1 rgx1startfw TAAGTTTAGCTAAGGCAGAG
Determination of the downstream end of the deletion +500 orf31do05kFw GAGGTACAGCGAATACAC
Cre1 amplification   Cre1fw TCTCTGGGCTCTCTTGTAACC