Skip to main content

Table 8 Specifications for the new intron mutants used in our study.

From: Correlation between the secondary structure of pre-mRNA introns and the efficiency of splicing in Saccharomyces cerevisiae

mutant segment location original sequence substitution/insertion
rps17b-L1 258–268 (11 nt) UGAAGAGAGGU augagacaacu
rps17b-L2 138–157 (20 nt) GAUUAGAAAACUCCAUUACU cuuaaguuaguaaauaccuc
rps17b-L3 22–47 (26 nt) UGAAGCCGGAUAUGAUGGACUGGGC uuaAGCCGcuacuacuUGGACUGucg
rps17b-L4 167–189 (23 nt) AGAAGAGCGCUCAAUGAAGUAGU uggcuuggguuaguaggugccuc
rps17b-S1 217–231 (15 nt) AAUUGCUUUCGAAUG uuucauguguucagc
rps17b-S2 280–286 (7 nt) UAAGUUG uacguac
rps17b-S3 246–253 (8 nt) AUCCAAUG uagCggcu
rps17b-S4 244–253 (10 nt) UUAUCCAAUG cuucaucaac
rps6b-L1 21–54 (34 nt) CCUUAGAAUUCUAAUGAAUCAGCACGCGCUAACC guauuuugggugugucccuguuauaaauaauacc
rps6b-S1 19–29 (11 nt) AUCCUUAGAAU uuuguuaguaa
rps6b-S2 87–113 (27 nt) CACAAAUUAGUGCACUAUAAUAAAAAU uuauaaauagugauaccauuugguaaa
rps6b-S3 21–57 (37 nt) CCUUAGAAUUCUAAUGAAUCAGCACGCGCUAACCGGC aaauuccaacguuucccugcaacaugccuuucuuccg
rps6b-S4 38–55 (18 nt) AUCAGCACGCGCUAACCG auucccaacagacugucc
rps6b-S5 337–345 GUAUUAUUU GgUguucAUUAUUacaU
ape2-L1 159–175 (17 nt) UGUUACCCUCAUAUUCU ggguacaauuaauagag
ape2-L2 237–252 (16 nt) GCAAUAGCUUAGGUAA ccuucguacuuuuggg
ape2-S1 23–37 (15 nt) CAAAGAAACAAGGAA agggcagaaauagaa
ape2-S2 43–57 (15 nt) AUACAUAAUAUAAAU aacugguagguacgu
ape2-S3 237–252 (16 nt) GCAAUAGCUUAGGUAA caaugaaugagaacuc
ape2-S4 159–175 (17 nt) UGUUACCCUCAUAUUCU aaauauuaccuaagcua
ape2-S5 300–322 (23 nt) CUCGUUACCGACCUUUGAGUUCU uuaagcuuuuguguuugagaaca
  1. The upper case letters represent the original sequences and the lower case letters represent substitution or insertion sequences. The first base of an intron is numbered 1.