Skip to main content

Advertisement

Table 3 Allelic variation in 39 SSR loci.

From: Gene-based microsatellite development for mapping and phylogeny studies in eggplant

Code Repeat FORWARD PRIMER (5'-3') REVERSE PRIMER(5'-3') Expected size of alleles (bp) Allele size range (bp) Nr. of alleles1 PIC2 SSR position3
       NA1 NA2 PICm PICs  
EEMS06 (T)14 TCATGCGAAGATTAATTAAATGTGA GAGTGGATGATCAAGAATGGC 265 268–274 1 4 0 0,174 3' UTR
EEMS07 (T)13 CCATGCCAGAATGGAAACTT AACGAAAACACGATCAACCC 247 250–260 1 4 0 0,209 3' UTR
EEMS10 (A)20 TCAAGCAGAACGAAGATGGA GTAGGGGACGTGGATTCAGA 282 266–290 1 4 0 0,174 3' UTR
EEMS12 (A)16 CGGGCAACTCTTCACATTTT ATTGGTTTGCTATCGAATTTCT 158 146–150 2 3 0,097 0,273 5' UTR
EEMS13 (A)14 TGAGATACGCGTACAATGACTTC GGGGTTTTGCTGCTGTTATC 140 140 1 1 0 0 5' UTR
EEMS14 (A)13 GGAATGGACCAAACCCCTAA AGAGCTTCGTTGCTTGGTGT 277 270–276 1 3 0 0,088 5' UTR
EEMS15 (C)12 GGGACAAATCTGACCTTTGG CTGGTGGCAAATTCTTCGAT 292 270–294 5 7 0,645 0,755 3' UTR
EEMS16 (AC)7 CAATTTTTCGGTTCACTAATCAAG CTTCAAGGAAAAAGGAGGCC 132 135–141 3 4 0,135 0,260 3' UTR
EEMS17 (CA)8 TGACATGTAGCTGGGCAGAG TGGAGTGTGCATCCCAAATA 197 195–197 2 2 0,492 0,499 3' UTR
EEMS18 (AG)7 GGAGAAACTGAAAAATTTGTAGAGAG GAGGAGTTTCCGACATGAGC 187 183–187 1 3 0 0,126 CDS
EEMS19 (AT)9 GGCATGACAAAATCATACAAACA TGTTGGTTAAGTCCATGGGAA 173 165–177 1 3 0 0,135 3' UTR
EEMS20 (AT)8 AACATCAGCCAGGGTGTTTC TGCTGAAAATTACAAGCCAAA 215 221–227 2 4 0,049 0,278 3' UTR
EEMS21 (AGA)5 TGATGTTGAACCGACACAAGA CGTCTTCATCTTCCTCCTCG 131 122–140 1 3 0 0,126 CDS
EEMS22 (AAG)5 GAAGGACGTTGGTCCTGGTA CTGTTCATTATCCCCATCGC 162 165–168 1 2 0 0,085 CDS
EEMS23 (TTC)5 CACCAATTTCCCCCTTCTTT CGGTTGGTAAAGAAAACCCA 144 145 1 1 0 0 CDS
EEMS24 (CTT)5 CACCTGTTTGAGCACCTTGA CACCGAAGGCAGAGAAGAAG 221 217–220 1 2 0 0,043 CDS
EEMS25 (CTT)5 CCCATAGCTTTGCTCGAGAT GCACCAAAGGCAGAGAAGAA 227 225–230 1 2 0 0,043 CDS
EEMS26 (CTT)5 GACACTCCCCTACTTCCACCT CGCTTAGCAGAAGCCGATAA 260 355–360 1 2 0 0,087 CDS
EEMS28 (TAA)21 GACGATGACGACGACGATAA TGGACTCACAACTCAGCCAG 219 180–236 7 9 0,665 0,714 3' UTR
EEMS29 (ATG)5 TCAGTCAACTGCATCACCAGA ATTCCCATTATTGGCTGCTG 118 120 1 1 0 0 CDS
EEMS30 (TAC)5 TTTACATGACAGCACCAGGC ATTTTATGGGAATGGGGTCC 191 189–195 1 2 0 0,087 3' UTR
EEMS31 (TGG)5 GAGAAGTTGGCTTCAGTGCC TAAACTCAAGGGATGCTGGG 239 330–339 1 2 0 0,043 CDS
EEMS32 (TCA)5 TAAGGAGTCTGATGCCGCTT GTAATGCTCCTCCACGGCTA 151 150 1 1 0 0 CDS
EEMS33 (TCA)5 CTATCTCCTTTTCCCCGACC ATGAATAAGCTGCCACCACC 220 222 1 1 0 0 CDS
EEMS34 (TCA)5 GCTTGATTCCCCACAAAGAA GTTTCATCGCCCTCATCATT 276 275–278 2 2 0,123 0,143 CDS
EEMS35 (TCA)5 ATGGCTTCTGATGGACCAAG CACTTGATGAACGTGGATGG 230 232 1 1 0 0 CDS
EEMS36 (TGT)5 TCTATCATCCCCAGATCCCA AAGGTCGCATGGACATTAGG 117 110–120 1 2 0 0,043 CDS
EEMS37 (TCC)5 CCCTTCCTACCCACACTTCA GTTTTGCACCTTTCCATCGT 117 114–123 2 4 0,375 0,502 CDS
EEMS38 (CAC)5 TTCAATCGAACTTCGGAACC ATGACGGTGGATCTCGCTAC 148 135–153 1 3 0 0,086 CDS
EEMS39 (CTG)5 GGAGAGATGGATGCCGAATA TCTCGACCTTAGCCTGCATT 166 264–270 1 3 0 0,126 CDS
EEMS41 (GCA)5 ATTCTGCATTCATCGGAAGG GGATTGCTTGTGGGAATATCA 260 700, 1600 1 1 0 0 CDS
EEMS42 (GCA)6 GCTCAGCAACCACAGTACCA GTCCGGACTTCATCAGCATT 152 155–180 1 3 0 0,166 CDS
EEMS44 (GCC)5 CCTTCAAACCCTCTCCCTTC GTGAAACGTGGTGGAGGTCT 216 215 1 1 0 0 CDS
EEMS45 (AGAACC)4 AGCGCTTGTCCAGGCTATAA TTTCCACCATGAGCAAATGA 282 279–285 1 2 0 0,197  
EEMS46 (ACCAGC)6 ACCAAACGTGCATGAAACAA GGAAATGTTGGTGGAATTGG 264 245–265 1 4 0 0,207 CDS
EEMS47 (GCT)5..(TTC)5 CGAACACATTCGCAAATCAC GCATCACAAGGATGGAAAGG 246 250–253 1 2 0 0,162 CDS
EEMS48 (TAA)20(CGA)8 CAATGCAAACAATTATCATTTCG TCGATGTTGTTGTCGTCGTT 213 223–241 7 9 0,641 0,677 3' UTR
EEMS49 (TA)12(GA)7 TGAAATTGATCAATACCTATAAATTTAG GAAAGCCAGGATAGCATTCG 140 145–153 5 5 0,677 0,677 3' UTR
EEMS50 (TA)9(GA)8 AAATCCGGCCATTCTGTGTA ACATCGTTCCGCCTCTATTG 224 218–226 2 4 0,229 0,377 5' UTR
  1. 1 NA1: number of alleles detected among the 38 cultivated types, NA2: number of alleles detected among the full 44 genotype set; 2 PICm: calculated among the 38 cultivated types, PICs: calculated among the full 44 genotype set; 3CDS: Coding sequence