Skip to main content

Table 1 Summary of gene targets evaluated by quantitative real-time PCR.

From: Effects of increased milking frequency on gene expression in the bovine mammary gland

Gene Amplicon size (bp) Sense primer (5'→ 3') Antisense primer (5'→ 3')
Microarray-identified genes
ALDH5A1 116 ccttctctgcaggttgaagc tcccacaaaatacagcatgaa
CIDEA 192 tcctacgacatccactgcac cccctaccctctcttgatcc
CTGF 175 tgtgcagttggagcaacagt cttccaggtggaaaaaccaa
ECM1 217 cgggatatcttgacccttga agttacgtcgggaaccacac
FGFR2 168 ttggcgaatcttcatcacag gtgagatcctgccagaggag
IGFBP6 161 aaggagagtaagccccaagc agcacggagtccagatgttt
MIA 172 tgtttctcggtgtcgtcttg atggtcaagaaacggcagtc
PHLDA1 131 gcaagtggactctggaccat tacaatgatgcggaaggaca
PTN 215 gctgaccaagtccaaacctc tcattttgtttctgcctattgtg
SERPINF1 245 gcctcagaaagtgacccaga cgcgatgttccacttgagta
SPADH1 176 ctgagcacccagcttctttc acaggctgagagcaggtgat
Sage-identified genes
GCHFR 123 tggccttctctgaaacctgt tttgacagaacagggccttc
GLYCAM1 115 caggcaaccacagagtcaga tgcatcactgggagtgtgtt
LTF 107 tcggttattctggtgccttc gtccctgtcagccttctctg
LALBA 125 ctctgctcctggtaggcatc acagacccattcaggcaaac