Skip to main content

Table 4 Markers, primers and thermal cycle conditions.

From: SNPs and Hox gene mapping in Ciona intestinalis

Marker Forward oligo (5' to 3') Reverse oligo (5' to 3') Cycle conditions
Hox1 GCATTGGGCCTTAATGAAACCC CTTCTGCTTCATACGTCGAT 95°C (3'). [94 (30"). 56°C. (30"). 72°C(1')]x34. 72°C. (3')
Hox2 CGGACTGCTTACACCAACACC TCGGCGCTTGTTACGTCACA 95°C (3'). [94 (30"). 55°C. (30"). 72°C(1')]x30. 72°C. (3')
Hox4 ACGCGACACCAGGTACTTGAA ATATGCACGGCCGTGGGAAA 95°C (3'). [94 (30"). 57°C. (30"). 72°C(1')]x30. 72°C. (3')
Hox10 GCAAGAAACGAGTGCCGTACA CTTCACTTGACGGTCGGTAAG 95°C (3'). [94 (30"). 57°C. (30"). 72°C(1')]x30. 72°C. (3')
Wd-40 TAGCTCGAGTTTGGGATATG TGGGTTAAGAGGGTGAGTGG 95°C (5'). [94 (1'). 54°C. (2'). 72°C(3')]x35. 72°C. (10'). 72°C. (3')
0100134706A TGTTCAGACCAGCATTACTGGC GAGATCGCATTACGGACATTG 95°C (3'). [94 (30"). 53°C. (30"). 72°C(1')]x30. 72°C. (3')
EvxA GGCCAACGTGCGTCGTTAT ACGGCCACGTCTGCCGTTGT 95°C (3'). [94 (30"). 55°C. (30"). 72°C(1')]x30. 72°C. (3')