Skip to main content

Table 1 STS markers used in the molecular analysis of the K locus.

From: Partial duplication of the PRLR and SPEF2 genes at the late feathering locus in chicken

Marker Name Location1 (bp) Position Sequence Length (bp)
STS_0 800926192 Forward CACACAGAAGACGGTGGATG 170
  800927882 Reverse TGGCTCCTACCTCCTGACAC  
STS_1 9764119 Forward GAAGGAGAGCCTGTTTGCTG 207
  9764325 Reverse CTTGTGGTGGTGAAGTGGTG  
STS_2 9862778 Forward AAGTGGGACAACGGAAAGAC 345
  9863122 Reverse AGGTCAAAGAAGGCACAAGG  
STS_3 9913200 Forward AGCCAGAAACAAAAGCCAAA 148
  9913347 Reverse TCAGCCTCGACACAGAAAAA  
STS_4 9933229 Forward AGTGTCAGTGTGCCTCTTGG 170
  9933398 Reverse CACGGCATTTATGAGATTGG  
STS_5 9950543 Forward AATCAGAGTTGCAGGGGTTG 135
  9950677 Reverse TTGACTGGGGCTCAATAAGG  
STS_6 9960545 Forward TCTCCCTCCCTGTCTTCTCA 215
  9960759 Reverse TGGCCTTGAAAATCCTCTTG  
STS_7 9973781 Forward TAGCAGACAAGGGCATTCAG 198
  9973584 Reverse GCATTTGTAGGGCTGGATTTG  
STS_8 9996871 Forward ACCAAAGCGTCCAAAATGTC 198
  9997068 Reverse TACCAGGGGAGAGCATGAAG  
STS_9 10038160 Forward AAATAGGCACGAGGGAAGC 176
  10037985 Reverse AACCATCAAGACTGGCTCAAC  
STS_10 10078039 Forward GCCCTCTAAGTGCCTGACTG 182
  10078220 Reverse TTTCATGCGTAGGAGCTGTG  
STS_11 10106858 Forward CACTTCCAGGGTTGGTGACT 343
  10107200 Reverse GAGGGCATCCATCACATCTC  
STS_12 10135701 Forward TGGAGCTGAGGAAAGAATCC 105
  10135805 Reverse TGCTTGCAGGTTTGAGTGTC  
STS_13 10168014 Forward TCCACTTGTCATGCACTTCC 179
  10168192 Reverse AAGTTCCCCAAAAATACTGCTG  
STS_14 10181226 Forward TGTGAGCAATTCCATTCTGG 216
  10181441 Reverse TTGGTTCAGTTTGGTCATCG  
STS_Junction 10141819 Forward CTGAGAGTGTTGTCCCAGCA 14323
  9966922 Reverse TGTTGAGTGCTCTTGGTTGC  
STS_Control 9899810 Forward ACGCTGGCTTTCCCAACAG 70
  9899879 Reverse AGACTGCCACATACCAGAAGCA  
STS_Break 10142644 Forward ACAAGTGTCAGACTAGGGCTAGCA 783
  9966396 Reverse TGAAACCATCCCTGGAGAGATG  
STS_5block 9965590 Forward ACCATTTCCACATTCCCTTCT 1333
  9966922 Reverse TGTTGAGTGCTCTTGGTTGC  
STS_3block 10141819 Forward CTGAGAGTGTTGTCCCAGCA 1289
  10143107 Reverse CGGGCCATTATTTCATTTTG  
  1. 1Genomic location on the Z-chromosome in basepairs (WASHUC2 assembly), 2Marker STS_0 is located on chromosome 1, 3in late feathering animals only.
\