Skip to main content

Table 1 PCR primers from sheep sequences identifying locus specific SNPs.

From: A map of the class III region of the sheep major histocompatibilty complex

Locus Forward Primer (5'-3') Reverse Primers (5'-3')
APOM GGTGGGTAGATTAGGGAGTC CACACTGGCTATGTTGACAC
BAT2 AGCGAGGAATACTTCTTTCC GCTGAGCAAGCTCATAAAAT
BAT5 GTTTGAGCACCTTCTCTCTG ATGGTGAGGGTTAAATTGG
C2 GACCCAGAAAGTGAAGATGT ACAGAAGGATGGAGTGAGTG
C2 GTTCCCTACCCCACAGAT CTGGGCCATTGTAGTTTTAC
G6B CCTAGAAGAGGGAGAAAAGC GGATCCTTGAGTCTAGTGGA
LTA TTTTCCAAACCAAGACACTT TAGAAGATGCTGCTGTTTCA
MSH5 GGAGCCTCCTAAGATTTGTC AACACAATCACAAGACAGCA
MSH5 GTCCTGAGCAAATCAGTCAT ACCTCTGATGATGAAACTGG
MSH5 TTGCAAAGAGTTCACACAAC CAGGTGACAGCTCTAAGCA
NG22 TTGTGAGGGTGGTGATAAAT GATGCTCTGGGAGATAGATG
TNXB ACCATCACCACAACAAAGAT GGACCTTGAAGGAGTCAAAT
TNF GAGCGGAGGTTCAGTGAT GGGTTCTTACCGGAATACTT