Table 1 Additional features on the gene subsets affected by amplification defaults. Hairpins, A stretches and promoter like sequences have been investigated. The parameters were the following: hairpins (minimal length: 10 nucleotides, maximal length: 100, maximal gap: 50), A stretches (size: 18A, maximal gap: 3), promoter of the T7 RNA polymerase (forward sequence: CCCTATAGTGAGTCGTATTA and reverse sequence, maximal gap: 6). Results on Panel 1 and 2 are summarised here. Statistical significance between subsets or features has not been evaluated.

From: Amplification biases: possible differences among deviating gene expressions