Skip to main content

Table 1 Additional features on the gene subsets affected by amplification defaults. Hairpins, A stretches and promoter like sequences have been investigated. The parameters were the following: hairpins (minimal length: 10 nucleotides, maximal length: 100, maximal gap: 50), A stretches (size: 18A, maximal gap: 3), promoter of the T7 RNA polymerase (forward sequence: CCCTATAGTGAGTCGTATTA and reverse sequence, maximal gap: 6). Results on Panel 1 and 2 are summarised here. Statistical significance between subsets or features has not been evaluated.

From: Amplification biases: possible differences among deviating gene expressions

  panel 1 panel 2
palindromes   
   ≥1 24/30 (80%) 45/65 (75%)
   ≥ 2 18/30 (60%) 22/60 (37%)
   >2 9/30 (30%) 10/60 (17%)
dA streches 3/30 (10%) 3/60 (5%)
promoter-like 8/30 (27%) 12/60 (20%)