Skip to main content

Table 2 Transcript level comparison of P. aeruginosa genes between real-time PCR and microarray analyses

From: Toxicogenomic response of Pseudomonas aeruginosa to ortho-phenylphenol

Gene amRNA level change with microarray bmRNA level change with real-time PCR Forward primer sequence (5'-3') Reverse primer sequence (5'-3')
  Fold change Fold change   
  20 min 60 min 20 min 60 min   
PA3049 -6.25 -25.907 -10.196 (± 0.14) -48.503 (± 0.35) TCGTGATCTTTGTCCGTTCACCCA CGTGCTGGAGTTGATTGAGACGTT
PA3724 -2.762 -10.256 -5.856 (± 0.21) -14.928 (± 1.27) TCATCACCGTCGACATGAACAGCA AGTCCCGGTACAGTTTGAACACCA
PA3622 -2.653 -2.967 -1.954 (± 1.95) -5.924 (± 1.60) TGACCACGATGATGAAGTGCTCCT TTGGAAGAGAAGGAAGTGGTGGCT
  1. The real time PCR results are the mean of three biological replicates with three technical replicates for each gene. The microarray results are the mean of four replicates of each gene.
  2. aThe microarray results are the mean of four replicates of each gene.
  3. bThe real time PCR results are the mean of three biological replicates with three technical replicates for each gene.
  4. cInternal control: glyceraldehyde-3-phosphate dehydrogenase