Skip to main content

Table 2 Comparison of the evenly-distributed MM probes and the MM probes designed using the MPDNN modeling parameter

From: Design and analysis of mismatch probes for long oligonucleotide microarrays

Name Type Sequence* RSI**
DVU0625_MM4 Evenly GCAGGCTATAACGACCTGAGGATCCAGGCACGTGAGATGATCCGCAAGGG 0.345
  MPDNN GCAGGCTATAACGACCTGATAATCCAGACCCGTGAGATAGTCCGCAAGGG 0.109
DVU1466_MM4 Evenly TGGCAAGGTAGGCGAAGTGGTGGGCGTGAGCACGACGCTGCTGCGTTCTC 0.527
  MPDNN TGGCAAGGTGGACGAAGTGATAGGCGTAAACACGACGCGACTGCGTTCTC 0.158
DVU1782_MM4 Evenly GGGTGGGAGGTGGTCTACAACCATCCTGCACTGTATTCCGTCGTCTTGAA 0.190
  MPDNN GGGTGGGAGAGGGTCTACAACCATCCTGCCCGGTATTCATTCGTCTTGAA 0.100
DVU2526_MM4 Evenly AAGGTCGAGAAGGTGAACCAGGAACAGATGGTGGAGCATATGGCCCACAG 0.345
  MPDNN AAGGTCGAGGAAGTGAACCCAGAACAGATAATGGAGCATGTAGCCCACAG 0.136
MMP0707_MM4 Evenly CAGAGGAGTGGTTCCTGCGACACTTGCGGAAATGATATAAACAAATATTA 0
  MPDNN CAGAGGAATAGTTCCTGCGACACTTGCGGCAGTGATATGCACAAATATTA 0.100
MMP0926_MM4 Evenly ATTAAACAGATTAAAGATGATTCAAAATCAAAAGTAAGAGTTAAATCATC 0
  MPDNN ATTAAACAGGGTAAAGATGATTCAAAATCCGAAGTAAGAAGTAAATCATC 0.042
MMP1559_MM4 Evenly ATTAAAAGCGGCAATTGGTGAAAAAACATGCCAAGTATCGAGAGTTCCAT 0
  MPDNN ATTAAAAGATGCAATTGGGAAAAAAACATGCCAAGTATCGAGAGTTCCAT 0.056
SO1362_MM4 Evenly GGTAGTTATGGTGGGCGGTGAAGGCCAGCGTGGCGGGCTATTTCAACAAA 0.353
  MPDNN GGTAGTTATAATGGGCGGTAAGGGCCAACTTGGCGGGCGGTTTCAACAAA 0.102
SO1779_MM4 Evenly CGCATTTCGGTTGGCAACCGTCAACAGGTGAAACAGAAGACATTCAAACT 0
  MPDNN CGCATTTCGGTTGGCAAACTTCAACAGGTGAAACAGAAAGCATTCAAACT 0.101
SO2452_MM4 Evenly GTTACATGAATTTGGTGATAGTCAAGATTAGCAGATCCTAATGCAACAAG 0
  MPDNN GTTACATGACTGTGGTGGTCGTCAAGAGTGGCAGATCCTAATGCAACAAG 0.101
  1. *The 50-mer MM probe sequences. The letters in shadow are the mismatched nucleotides.
  2. **The predicted relative signal intensity (RSI) using the MPDNN model.