Skip to main content

Advertisement

Table 1 Real-time PCR primers

From: In silico identification and molecular characterization of genes predominantly expressed in the fish oocyte

Name Acc # Forward primer Reverse primer
zar1 EU124662 GAACGAGCAAGGTCTACTTCAAG GCAAGTCTGGCAGGTGATGTC
mos EU276588 GGCGACAGGCAATATGTTTT CACTTGGACACAATGGATCG
gdf9 EU723245 ACGAGCGACTGTGCTTTGTAC AATGATCCAATGGCTCAGTT
btg3 EU723246 AGAGGAGGTGTGCTGCAGAT CGTCTGAGGAGGAACAGGAG
msh4 EU723247 TCTGTCTGCGAATTCCTCCT ACCTCCATGTGCTGGTTTTC
18S AF308735 CGGAGGTTCGAAGACGATCA TCGCTAGTTGGCATCGTTTAT
  1. For all studied genes the GenBank accession number of the rainbow trout cDNA and the sequence of the primers used for the real-time PCR study are shown