Skip to main content

Table 3 Novel human miRNA sequences identified by cloning from NB

From: New miRNAs cloned from neuroblastoma

Sequence name Sequence Chromosomal location Northern blot validation Reads Notes
MYCNAMP_NB2_5 aaggagcttacaatctagctggg 11q14.1 + 1 predicted gene
MYCNSC_NB2_148 acccagcaccccaggtttccacag 12q13.12 - 1 Tubulin-K-alpha-1
MYCNSC_NB5_330 taggacacatggtctacttct 14q32.31 + 1 within miRNA cluster
MYCNAMP_NB2_61 tcaaaactgaggggcattttct 19q13.42 + 4 within miRNA cluster
MYCNAMP_NB4_70 cctgtgttttgttggtagcctgtgttac 2q14.1 - 1 DPP10
MYCNSC_NB8_202 ccagacagaattctatgcactttc 3p12.3 - 1 KIAA0664
MYCNSC_NB5_41 tcaccccataaacacca 3p13 + 1 Extragenic
MYCNSC_NB5_281 tccattacactaccctgcctct 3p25.3 - 1 Plasma membrane calcium ATPase isoform 2
KELLY_276 tcgattcccacccctgacacca 4q13.1 + 1 Extragenic
MYCNSC_NB3_226 ctgccctggcccgagggaccga 5q31.2 - 1 Kelch-like-3
CONTIG_CHR_9 tgcaggaacttgtgagtctcc 9p21.1 + 4 Extragenic
MYCNSC_NB5_318 tggatttctttgtgaatca 9p21.1 + 1 Extragenic
MYCNAMP_NB2_241 cagggaggtgaatgtgat Xq21.2 - 1 Extragenic
MYCNSC_NB5_64 aagctaattttttgaggcc 15q22.31 NA 1 U5 predicted, borderline case
MYCNSC_NB2_237 gatgatgctgctgatgctg 8p23.1 + 1 Pin2-interacting protein X1
  1. Notes include the information about genomic locations and additional sequence information.