Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Oligomers used for RT-PCR

From: MFS transportome of the human pathogenic yeast Candida albicans

Oligomer Sequence (5'-3') Expected amplicon length (bp)
MDR1-F CACCGTTATGGAACCAGTTG 330
MDR1-R CAGCACCAAACAATGGACCAACCCAATGAG  
orf19.1582-F GAAACTTTGGTATCCTGGAAC 380
orf19.1582-R CAACAAAATGGCAAAACCACC  
orf19.7336-F CGCTTTCCAACCATCAATGG 464
orf19.7336-R CAGTCATTGAAGAAGCAGAAG  
orf19.4090-F GAGAAGGGGCGTTTTTATTG 301
orf19.4090-R CACAATGAAAACCGGTAACAC  
orf19.6180-F GGTTGTTGTTAGGTGTGTTG 394
orf19.6180-R CAAAATCTCGTAAACCCACG  
orf19.1424-F CAGTACAAACATTACAAGCCC 476
orf19.1424-R CACCACAAATGTCATACCAC  
orf19.6520-F GCCTTACATCCACGCAATTTG 339
orf19.6520-R CTAAAATCTAACCTCTTGGCGC  
orf19.6654-F CTATTGGGTTGTTGGGTTTG 286
orf19.6654-R GTCGAGCCTCCAATAATACCTG  
orf19.6976-F CTCCCCCTTGGTTATATTAAC 603
orf19.6976-R CCAGGCCAACCATTTTTCAAAG