Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 ssDNA sequences of the oligonucleotides used in padlocks, target molecules and primers (5'-3' orientation).

From: Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction

Name 5' target cZIP sequence 3' target Target gene (GenBank:) Size (nt)
Cotton sp. CTGGGCTGAGAACAACATTCTGACTCACCTCAAACCA AAGTGTGCCAGACGCTCGAA CTTTAAATCTTTGGAGGG [AJ132636] (sad1) 122
Maize sp. CTGTGGCATCATCACTGGCATCGT GTACTACATTCGTGCGATGG TTAGGCGTCATCAT [AF371266] (zein) 124
Canola sp. GTGACGCATACGTTCTATAACATCAGCCTGTCC CGTCGCGTTAGACAGCTCAT CCGATCTTTCTTGTATTC [DQ173668] (ACCase) 118
Soya sp. GCATCATAGGTAATGAGAACCTTGGCTACTTTATTGTTGGCC ACTCCAGTGCCAAGTACGAT AGAGGCTGGTGGAG [K00821] (lectin1) 142
RRS event GATCCCAAATAGTTTTGTTTTTCTAACAACGAGAAGCTATATGTAGATGCTATT AACAACGATGAGACCGGGCT TCAAACAGTTCTTCTCC [AJ308515] 138
MON810 GGCAATGGCAAAGGATGTTAAACGTTAGAGTCCTTCGT TGCCCTATTGTTGCGTCGGA AAAGTGACAGATAGCTG [AF434709] 141
Bt176 event GAACATCAGATCTCGGTGACGGGCAGGACC TAATCTAATTCTGGTCGCGG GCATCAATGGAGGAGA [AJ878607] 113
CaMV P35S CGAAGGATAGTGGGATTGTGCGTCATCCCTTACG CCACGAGCTGTAATCCGGTA ATAGAGGAAGGGTCTTG [V00141] 118
FMV P35S TCTTCGGTGGATGTCTTTTTCTGAAACTTACTGACCATGATG GTGATTAAGTCTGCTTCGGC GCCCACTAACTTTAAG [X06166] 125
bar TCGATGTAGTGGTTGACGATGGTGCAGACCG CGAGTGCTCCGTGCGAAATA TGACCGTGCTTGTC [AY346130] 112
SpikeLock CGTCGGACAGGTTACTTTCGAAGAGCCGGAATACTC GCTGAGGTCGATGCTGAGGTCGCA (cZIP-P for Positioning) CGAAGGTCATATCTCG   123
ZB3   CGTGCAAGTTACCGAGCTGA    20
  primer sequence     
Fwd primer GCAAGAGATGGGCTACAGAGGAT     23
Fwd25 primer CCGCAAGAGATGGGCTACAGAGGAT     25
Rev primer GGACAGACACGCTAAGACAGAACT     24