Skip to main content

Advertisement

Table 3 Selected qRT-PCR primer sequences and accession numbers

From: Transcriptome profiling of the feeding-to-fasting transition in chicken liver

Gene symbol Gene name Ensembl or Gene bank Accession number Primer sequence (forward/reverse)
ACACA Acetyl-Coenzyme A carboxylase alpha ENSGALG00000005439 GAGGAGGGAAGGGAATTAGGAA
CCAAGTGGCGGGACTGTT
ACOX1 Acyl-Coenzyme A oxidase 1 ENSGALG00000002159 TCATCCGGTCTCTGATTGTAGGA
GCACTATAGCGGATGGCAATG
ACLY ATP citrate lyase ENSGALG00000003475 GGCGTGAATGAACTGGCTAAC
TAGTCTTGGCATAGTCATAGGTCTGTTG
CPT1A Carnitine palmitoyltransferase1A ENSGALG00000007077 CCCTGAAAATGCTGCTTTCCTA
TGGTGCCTGCAGAAAGTTTG
CPT2 Carnitine palmitoyltransferase II ENSGALG00000010681 CCTGAACGCCCAGAAACCT
CCCTTTTCAAACTGATGAGCAAGT
CYP7A1 Cytochrome P450, family 7, subfamily A, polypeptide 1 ENSGALG00000015432 TGATGACATGGAAAAAGCAAAGA CCAAAAAGTAGCAGGAATGGTGTT
EHHADH Peroxisomal bifunctional enzyme ENSGALG00000006680 TCATAGAAAGGAGCGAGAAGC
AGCAGGAACCCCAACCAGT
FADS1 Fatty acid desaturase 1 ENSGALG00000007127 CAGCACCACGCGAAACC
TCTACAGAGAGCTTCTTTCCCAAAG
FADS2 Fatty acid desaturase 2 ENSGALG00000007178 CCATGATCAAGCGCAGGTT
ATGTATGTGATGAAATAGCGCATGTAG
FASN Fatty acid synthase ENSGALG00000002747 TGAAGGACCTTATCGCATTGC
GCATGGGAAGCATTTTGTTGT
HMGCS1 Hydroxymethylglutaryl-CoA synthase, cytoplasmic ENSGALG00000014862 GCTGGTGCTGTTGCTATGCT
TGTCTGTCCCCTCTTTTTGC
HMGCS2 Hydroxymethylglutaryl-CoA synthase, mitochondrial ENSGALG00000002960 GGTGGTGTGTGGGGACAT
GGTAGCACTGGATGGAGAGG
HMGCR 3-hydroxy-3-methylglutaryl- Coenzyme A reductase ENSGALG00000014948 CTGGGTTTGGTTCTTGTTCA
ATTCGGTCTCTGCTTGTTCA
NR1H3 Nuclear receptor subfamily 1, group H, member 3 (LXRα) ENSGALG00000008202 TCCCACTCAACTCAGCACAC
CAGACTTCATTTCCCAGCATC
PCK1 Phosphoenolpyruvate carboxykinase, cytosolic ENSGALG00000007636 CTGCTGGTGTGCCTCTTGTA
TTCCCTTGGCTGTCTTTCC
PPARA Peroxisome proliferative activated receptor, alpha ENSGALG00000022985 AGCATCCAGTCCTTCATCCA
AAAAACCCTTACAACCTTCACAA
SCD Stearoyl-CoA desaturase(delta-9-desaturase) ENSGALG00000005739 TTTGGCAATCGGCCGTAT
TGGTAGTTGTGGAAACCTTCTCCTA
SREBF1 Sterol regulatory element binding protein 1 gb:AY029224 GTCGGCGATCCTGAGGAA
CTCTTCTGCACGGCCATCTT
SREBF2 Sterol regulatory element binding protein 2 ENSGALG00000011916 GGCTGGCTTCTCCCCCTAT
GTTCATCCTTAACCTTTGCATCAT
  1. Genes in bold were present on the microarray.