Skip to main content

Table 2 Microsatellite markers' characteristics and genetic variability

From: Isolation and characterization of microsatellite markers from the olive fly, Bactrocera oleae, and their cross-species amplification in the Tephritidae family

Marker Primer pairs E.S Tm Samples N na ne Ho He HWEG2
Boms2 F: GCTGTTTTGAATGTCAGCATC
R: TGTATGCGTGACTGTTTACG
128 50 wild
laboratory
20
13
3
3
1.75
2.15
0.45
0.54
0.44
0.56
-
-
Boms3a F: CAGTCGCCCTTTAATTTGC
R: GGGTCCTTTTGTTCTCAGG
176 50 laboratory 32 4 2.39 0.63 0.59 -
Boms3b F: AGGACCCTGGCACAATTCG
R: TATGGCATGGCAAGCAGC
171 50 laboratory 32 4 2.26 0.59 0.57 -
Boms5 F: TCTCGCCCCAATTACCAC
R: GAATTTTGGCAACATCCAAGC
105 50 laboratory 34 4 3.25 0.79 0.70 -
Boms6a F: TCACTAAAAGGAGTCCGCAC
R: GAGCAGGTCAGAGGCAAAAG
173 50 laboratory 35 3 1.64 0.43 0.39 -
Boms6b F: AAACCTTACCCTTTTGCCTC
R: AGTGCCAACTGAATGCTG
118 50 laboratory 35 3 2.10 0.49 0.53 -
Boms8 F: TGACATACATGCCTTCATTCAC
R: CAGAAAAGCTTAAAACTAGCGG
75 50 wild
laboratory
20
9
6
3
3.10
2.66
0.85
0.56
0.69
0.66
-
-
Boms10 F: CAGAGCATCTCGCTTTGG
R: TCAACAATCCCAGCAAAATC
172 50 wild
laboratory
20
33
5
2
3.33
1.27
0.70
0.12
0.72
0.22
-
+
Boms11 F: ATAGGCATTGGCAGCGAAG
R: CACAGTGGGCCGAAATCAC
185 50 wild
laboratory
20
25
4
2
1.88
1.68
0.50
0.32
0.48
0.41
-
-
Boms12 F: CGCGTTTTCATACTTTAACACC
R: TTCATTTGGCCTTTGTGC
158 50 wild 19 3 1.17 0.16 0.15 -
Boms14 F: TTTGTAATTCGCAGAAGGCAC
R: AGGAGGACTGACAGAAGGACAC
147 50 wild 8 4 2.72 0.38 0.68  
Boms16 F: CAGACAATGGATGGATACATGC
R: GGAGAAGTCAAATTGTGACAGC
109 50 wild 20 5 1.72 0.50 0.43 -
Boms17 F: ATTAGACCATAGTGTTCTCAC
R: AAGATGTTGAGTGCCGTTG
170 50 wild
laboratory
20
31
7
5
5.76
1.41
0.35
0.19
0.85
0.29
+
-
Boms18 F: GCCATGAATGCAGACCAC
R: CCTATTCAAATGCACGCAAAAC
171 50 wild
laboratory
20
33
6
3
2.56
1.94
0.80
0.39
0.63
0.49
-
+
Boms21 F: TCGCCTCTTACCTCACAACC
R: ACCATCCTTAGTCAGCACAGTC
188 50 wild
laboratory
20
28
6
4
3.77
1.16
0.75
0.14
0.75
0.14
-
-
Boms22 F: GTAAAGCACACGGAAGCG
R: TGAGGTCAAAAAGGATGCTAAG
211 50 wild
laboratory
18
7
2
2
1.06
1.32
0.06
0.29
0.06
0.26
-
-
Boms24 F: ATTTCGCTTGCCACAAAC
R: CGCCCAAGCACTTAAAAC
215 50 laboratory 33 2 1.77 0.39 0.44 -
Boms25 F: TGGAATGCGCTATTTTGTTG
R: ACTCGTATATACGTACATGG
167 50 wild
laboratory
20 33 5
3
3.49
2.16
0.80
0.55
0.73
0.55
-
-
Boms27 F: CGACTTGAAGGACAATTGG
R: GGCGTGAGTAGTTTCTATAAGC
129 50 wild
laboratory
20
10
5
3
2.02
2.41
0.55
0.50
0.52
0.62
-
-
Boms29 TGAAGGTGATGAATGAAAGC
GGAATGACTGTGAGCAAGC
118 50 wild
laboratory
20
13
5
1
2.57
1.00
0.60
0.00
0.63
0.00
-
Boms30 F: CTGACTTCTTGCTTTACACG
R: CAGCTTATCTGCTTTAAGTGC
150 50 wild
laboratory
20
9
4
4
2.12
2.19
0.70
0.78
0.54
0.58
-
Boms31 F: TGCTTGAGTTGCTCGTTGG
R: GCCGCATGACATAAAGAATCG
173 50 wild
laboratory
20
30
4
2
3.27
1.03
0.75
0.03
0.71
0.03
-
Boms32 F: TGTATGTATTTGTGCGTCG
R: GCTTAGACCATTTGCTCC
125 50 wild 20 7 3.96 0.55 0.77 -
Boms34 F: ACGCCGCACACTTCTTAAAC
R: CACCCAACTTTTGTAGTTTCC
219 50 laboratory 34 3 2.08 0.65 0.53 -
Boms47 F: CAAACACACGCTAAAACG
R: TTTAACCCAGAGGCTTGC
158 50 wild 18 6 3.15 0.61 0.70 -
Boms58 F: AGTTGGACGCGCACATATC
R: AGCGCGTACGAGCTTTAGC
181 50 wild
laboratory
18
30
7
3
5.02
1.15
0.72
0.13
0.82
0.13
-
-
Boms59 F: AGCGCTTACATAAATATAGCTAC
R: TCCCCGTAAAGCCATAAAGTC
171 50 wild 20 5 2.27 0.50 0.57 -
Boms60 F: TGGACGCGCACATATCAG
R: ACGACGTTTAGCGGAAATGAG
170 50 wild
laboratory
20
37
6
3
3.14
1.21
0.70
0.19
0.70
0.18
-
-
Boms62 F: CTTTCGCTGCCTCCATTTG
R: CAAAACCCCTCTGCAATCC
174 50 wild 20 2 2.00 0.55 0.51 -
Boms64a F: TGCTAGGCTGAACATTCG
R: TGTTTTGCTGTTTCCAGG
129 50 wild 20 Multiple bands  
Boms64b F: TGGAAACAGCAAAACACC
R: AGCGAATCAAGAGACAGC
137 50 wild 10 Multiple bands  
Medflymic9 Stratikopoulos et al., submitted 50 wild 8 3 2.42 0.88 0.63  
Medflymic142 >> 50 wild 9 monomorphic  
Medflymic149 >> 50 wild 8 monomorphic  
Medflymic150 >> 50 wild 8 3 2.03 0.50 0.54  
Medflymic151 >> 50 wild 20 5 2.66 0.35 0.64 +
Medflymic152 >> 50 wild 20 6 5.00 0.40 0.82 +
Medflymic153 >> 50 wild 20 3 2.24 0.40 0.57 -
Medflymic154 >> 50 wild 10 monomorphic  
Medflymic157 >> 50 wild 10 monomorphic  
Medflymic158 >> 50 wild 8 3 2.25 0.63 0.59  
Medflymic163 >> 50 wild 10 monomorphic  
Medflymic22 >> 55 wild 20 Multiple bands  
Medflymic23 >> 55 wild 20 monomorphic  
Medflymic29 >> 55 wild 20 Multiple bands  
Medflymic40 >> 55 wild 20 Multiple bands  
Medflymic61 >> 55 wild 20 4 2.32 0.45 0.58 -
Medflymic64 >> 55 wild 20 monomorphic  
Medflymic72 >> 55 wild 20 monomorphic  
Medflymic109 >> 55 wild 20 2 1.05 0.05 0.05 -
  Mean wild (monomorphic excluded)
Mean laboratory (monomorphic excluded)
  19.5
26.5
4.63
3.14
2.74
1.90
0.53
0.44
0.57
0.44
 
  1. E.S: Expected size
  2. Tm: PCR annealing temperature
  3. N: sample size
  4. na: actual number of alleles; ne: effective number of alleles
  5. Ho: heterozygosity observed; He: heterozygosity expected
  6. (-): in HWE; (+): out of HWE
\