Skip to main content

Advertisement

Table 2 Set of primers designed with the 1st approach (Fig. 1A) to amplify genomic regions with candidate SSRs in a broad range of Phytophthora species (Table 1).

From: Use of genome sequence data in the design and testing of SSR markers for Phytophthora species

  Forward primers(a) Reverse primers(a) SSRs(a) Source(b)
P. sojae S1F ACGACGTGTCCAAGAACCAC S3R ATGTTGACCGTGTTCTGCTG (CCG)7;(AGC)4; (AGC)14 scaffold_3: 1346836–1347814
  S4F AARATGACGTGGACKGAGAG S5R TGATSGTGGAGAARCTCATCT (AAC)14 scaffold_14: 861958–862585
  S6F GGAGTTCGCCATCAACAACT S7R TCAGCTTCTGTCGRTCGAC (AAG)14 scaffold_24: 159790–160289
  S8F YGYGTCTCGCCCAYGAC S9R GACGACACCGGSGAGAG (ACC)4;(AGC)4; (AGC)28; (AAC)4 scaffold_76: 171071–172890
  S10F GCGSTACGAGACCTGGAC S11R GACTCRCCCTTCGACTCSTC (CAG)14  
  S12F GGAGGCCGAGTCGGARTA S13R TAYTCCGACTCGGCCTCC (AGC)14 scaffold_136: 56988–57479
  S14F GACGCMSYYGAGTGGAAAG S15R ATTTKGSACAGATACCGACG (AAG)15 scaffold_65: 332082–332852
  S16F TCTACGTGAATGCCATGAGG S17R CGTTCAGCTTCTGTCGATCR (AAG)15 scaffold_79: 50973–51428
  S18F YACCATCTCCAACCTGCTG S19R CACCACCTCGAGTAGCTCCC (AGC)7; (AGG)13 scaffold_2: 1159730–1160958
  S19F GGGAGCTACTCGAGGTGGTG S20R TCGTCTCAATCTCKGACTGA (AGC)6  
  S21F ATCTGGGCTTCCASGAGGT S22R CTGATCCTCCGCCACAY (AAG)12; (ATC)6; (ATC)4; (AAG)5 scaffold_138: 18289–18854
  S23F GACTCGGACTCGGACGAC S25R CTCCTGCTCKTCTTTCAGGC (AGG)7; (AAG)10; (GAG)4; (AAG)12; (GAG)5; (AGA)6 scaffold_90: 249340–250137
   S37R CTTRCCBTCCTTGTCCTTYT   
  S27F GAAGCGCGGGCGWGT S31R TCCTCCTCTTCTTCTTCGTCW (AAG)4; (AGG)4; (ACG)4; (AGG)11 scaffold_16: 680126–681136
  S31F WGACGAAGAAGAAGAGGAGGA S28R TCATTCATCAGCGTGTCRAT (GAG)4  
  S34F ABGAWGACGABGAGGAVGAV    
  S29F MGCAAGAAGGCGTCGTA S30R CCTTCATCATGAGCTTCTGG (AGG)4 (AAG)11 scaffold_40: 353572–354360
P. ramorum R1F GYGGCGGTGGCTACAGYG R3R CTGCTGYTGCTGGTTGAAAG (ACC)4; (ACC)5; (ACC)4 scaffold_23: 349447–350425
  R2F CTACTCSAGCCGCTACGC    
  R3F CTTTCAACCAGCARCAGCAG R4R GTTCATCATGCCWCCCATR (AGC)8 scaffold_23: 350406–351828
  R4F YATGGGWGGCATGATGAAC R5R AGGACCAGGAGATGGAGGAC (AGC)4; (AGC)12; (AGC)4  
  R7F TGTTCCARACCCGCTTCC R8R CACCAAGCAGCACKCGC (ACG)9; (AAC)5; (AGC)10 scaffold_10: 436897–437690
   R9R GGAACGCACCAAAGACGC   
  R10F GGAGATGACGGAAGATGACG R11R CCATCGAARTACATSACACGA (AAGCC)4; (AGG)9; (AAG)7 scaffold_5: 750031–750612
  R13F AAGTCGAAGCTCGTGGTSAC R14R GTATCCGCTGRAAGAGCGTC (AAG)10 scaffold_78: 40203–40815
  R15F CCGGAGCGCGTGGA R16R GGTAGTTGAGCGGCTTCTTG (CCG)6 scaffold_2778: 35–305
  R16F CAAGAAGCCGCTCAACTACC R17R TAACGGATCAGCTCTTGCTG (ATC)4; (AGG)8 scaffold_2778: 286–1134
P. infestans I3F GCCTGTGGAYGAGAATGGYS I4R CAGATCCACGACACCRGGY (AAG)8 Pi_002_41652 _Feb05
  I5F CATCAACAAGTGCTCGTWCS I6R TAGTCRAYGTTCTTGTTGTTCA (AGC)5; (AGC)8 Supercont1.7 842678–843649
  I7F GHGTGGGCGAGTACTCCAAG I8R AAGCTGGCTATRWACACTGCCG (AG)9 Supercont1.4 1481811–1482015
  I9F GCATYGGGTCGTTCCTGTA I10R AGHGTGCAGTACAGACCCGC (AAG)11 Supercont1.5 1235771–1236143
  I11F TCGTCBGTGTCCTCBACGTC I12R ACCAGCATCTTRTTCTGRGCAG (ACC)8 Supercont1.45 522394–522633
  I13F GTCTGCGCTGTCGGAACT I14R TRATGATGCGGTTCATCTCG (AAG)7; (AAG)4 Supercont1.220 167896–168460
  1. (a) = Primers are listed according to the localization in their respective genome projects (P. sojae, P. ramorum or P. infestans) and according to the flanked SSRs. In some circumstances, a pool of different primers was designed to amplify selected genomic regions from as many as possible Phytophthora species. Similarly, when target regions contained two or more SSRs and were too long to be amplified by a single amplification a pool of different primers was designed.
  2. (b) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html (P. sojae), http://genome.jgi-psf.org/ramorum1/ramorum1.home.html (P. ramorum) and http://www.pfgd.org/ or http://www.broad.mit.edu/annotation/genome/phytophthora_infestans/Home.html (P. infestans).