Skip to main content

Advertisement

Table 2 Set of primers designed with the 1st approach (Fig. 1A) to amplify genomic regions with candidate SSRs in a broad range of Phytophthora species (Table 1).

From: Use of genome sequence data in the design and testing of SSR markers for Phytophthora species

  Forward primers(a) Reverse primers(a) SSRs(a) Source(b)
P. sojae S1F
ACGACGTGTCCAAGAACCAC
S3R
ATGTTGACCGTGTTCTGCTG
(CCG)7;(AGC)4; (AGC)14 scaffold_3:
1346836–1347814
  S4F
AARATGACGTGGACKGAGAG
S5R
TGATSGTGGAGAARCTCATCT
(AAC)14 scaffold_14:
861958–862585
  S6F
GGAGTTCGCCATCAACAACT
S7R
TCAGCTTCTGTCGRTCGAC
(AAG)14 scaffold_24:
159790–160289
  S8F
YGYGTCTCGCCCAYGAC
S9R
GACGACACCGGSGAGAG
(ACC)4;(AGC)4; (AGC)28; (AAC)4 scaffold_76:
171071–172890
  S10F
GCGSTACGAGACCTGGAC
S11R
GACTCRCCCTTCGACTCSTC
(CAG)14  
  S12F
GGAGGCCGAGTCGGARTA
S13R
TAYTCCGACTCGGCCTCC
(AGC)14 scaffold_136:
56988–57479
  S14F
GACGCMSYYGAGTGGAAAG
S15R
ATTTKGSACAGATACCGACG
(AAG)15 scaffold_65:
332082–332852
  S16F
TCTACGTGAATGCCATGAGG
S17R
CGTTCAGCTTCTGTCGATCR
(AAG)15 scaffold_79:
50973–51428
  S18F
YACCATCTCCAACCTGCTG
S19R
CACCACCTCGAGTAGCTCCC
(AGC)7; (AGG)13 scaffold_2:
1159730–1160958
  S19F
GGGAGCTACTCGAGGTGGTG
S20R
TCGTCTCAATCTCKGACTGA
(AGC)6  
  S21F
ATCTGGGCTTCCASGAGGT
S22R
CTGATCCTCCGCCACAY
(AAG)12; (ATC)6; (ATC)4; (AAG)5 scaffold_138:
18289–18854
  S23F
GACTCGGACTCGGACGAC
S25R
CTCCTGCTCKTCTTTCAGGC
(AGG)7; (AAG)10; (GAG)4; (AAG)12; (GAG)5; (AGA)6 scaffold_90:
249340–250137
   S37R
CTTRCCBTCCTTGTCCTTYT
  
  S27F
GAAGCGCGGGCGWGT
S31R
TCCTCCTCTTCTTCTTCGTCW
(AAG)4; (AGG)4; (ACG)4; (AGG)11 scaffold_16:
680126–681136
  S31F
WGACGAAGAAGAAGAGGAGGA
S28R
TCATTCATCAGCGTGTCRAT
(GAG)4  
  S34F
ABGAWGACGABGAGGAVGAV
   
  S29F
MGCAAGAAGGCGTCGTA
S30R
CCTTCATCATGAGCTTCTGG
(AGG)4 (AAG)11 scaffold_40:
353572–354360
P. ramorum R1F
GYGGCGGTGGCTACAGYG
R3R
CTGCTGYTGCTGGTTGAAAG
(ACC)4; (ACC)5; (ACC)4 scaffold_23:
349447–350425
  R2F
CTACTCSAGCCGCTACGC
   
  R3F
CTTTCAACCAGCARCAGCAG
R4R
GTTCATCATGCCWCCCATR
(AGC)8 scaffold_23:
350406–351828
  R4F
YATGGGWGGCATGATGAAC
R5R
AGGACCAGGAGATGGAGGAC
(AGC)4; (AGC)12; (AGC)4  
  R7F
TGTTCCARACCCGCTTCC
R8R
CACCAAGCAGCACKCGC
(ACG)9; (AAC)5; (AGC)10 scaffold_10:
436897–437690
   R9R
GGAACGCACCAAAGACGC
  
  R10F
GGAGATGACGGAAGATGACG
R11R
CCATCGAARTACATSACACGA
(AAGCC)4; (AGG)9; (AAG)7 scaffold_5:
750031–750612
  R13F
AAGTCGAAGCTCGTGGTSAC
R14R
GTATCCGCTGRAAGAGCGTC
(AAG)10 scaffold_78:
40203–40815
  R15F
CCGGAGCGCGTGGA
R16R
GGTAGTTGAGCGGCTTCTTG
(CCG)6 scaffold_2778:
35–305
  R16F
CAAGAAGCCGCTCAACTACC
R17R
TAACGGATCAGCTCTTGCTG
(ATC)4; (AGG)8 scaffold_2778:
286–1134
P. infestans I3F
GCCTGTGGAYGAGAATGGYS
I4R
CAGATCCACGACACCRGGY
(AAG)8 Pi_002_41652
_Feb05
  I5F
CATCAACAAGTGCTCGTWCS
I6R
TAGTCRAYGTTCTTGTTGTTCA
(AGC)5; (AGC)8 Supercont1.7
842678–843649
  I7F
GHGTGGGCGAGTACTCCAAG
I8R
AAGCTGGCTATRWACACTGCCG
(AG)9 Supercont1.4
1481811–1482015
  I9F
GCATYGGGTCGTTCCTGTA
I10R
AGHGTGCAGTACAGACCCGC
(AAG)11 Supercont1.5
1235771–1236143
  I11F
TCGTCBGTGTCCTCBACGTC
I12R
ACCAGCATCTTRTTCTGRGCAG
(ACC)8 Supercont1.45
522394–522633
  I13F
GTCTGCGCTGTCGGAACT
I14R
TRATGATGCGGTTCATCTCG
(AAG)7; (AAG)4 Supercont1.220
167896–168460
  1. (a) = Primers are listed according to the localization in their respective genome projects (P. sojae, P. ramorum or P. infestans) and according to the flanked SSRs. In some circumstances, a pool of different primers was designed to amplify selected genomic regions from as many as possible Phytophthora species. Similarly, when target regions contained two or more SSRs and were too long to be amplified by a single amplification a pool of different primers was designed.
  2. (b) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html (P. sojae), http://genome.jgi-psf.org/ramorum1/ramorum1.home.html (P. ramorum) and http://www.pfgd.org/ or http://www.broad.mit.edu/annotation/genome/phytophthora_infestans/Home.html (P. infestans).