Skip to main content

Advertisement

Table 7 Set of primers designed with the 2nd approach (Fig. 1B) to amplify genomic regions potentially containing SSRs in Phytophthora species of clade 7 [2].

From: Use of genome sequence data in the design and testing of SSR markers for Phytophthora species

Forward primer Reverse Primer SSRs Source(a) Gene(b)
S38F
TCGTSTTCTACGTGCTGGAY
S39R
GTAGCACGCGAACATGAASA
(AAC)18 scaffold_26:
667079–667377
E
S40F
TTCCTTAAGTGGGGGAGGAT
S41R
TRTCGGCRTTCAGCTTCTGT
(AAG)4; (AAG)22 scaffold_125:
153837–154222
I
S42F
GCTGCAAGAGTCSCTCGAGTA
S43R
CTTGAGGATGTCRATGAGCA
(AG)21 scaffold_89:
132819–133248
I
S44F
GTRGCTCCTTCCTTAAGTGG
S45R
GTGCTGCASGTAYGGCTTC
(AAG)17 scaffold_75:
344500–344901
I
S46F
GTTGCGCGTGAGGTTCTC
S47R
CAAAAGCTCTGCGTCC
(AG)22 scaffold_67:
282390–282656
I
S48F
YCGGGCSACGGTAGG
S49R
AAGAGCGTRAGCAGGAACC
(AG)18 scaffold_65:
225236–225440
I
S50F
GTGGCTTCCACTGYTGCTG
S51R
YATCAAGGACGTCAACTCGA
(AAC)9; (AACAGC)23 scaffold_48:
118994–119610
E
S52F
CGGGATTTRTCRGATCAGG
S53R
CTGTYTGATCARCTCTCCGCT
(AGG)19 scaffold_46:
153312–153646
E
S56F
CACGAGCTGCAGKCATAYCT
S57R
AGAATKGAMGCGATCGAC
(AGG)16 scaffold_21:
370731–371140
E
S58F
TCGATCRACAGAAGCTGCWA
S59R
GGAGTTCGCCATCAACAACT
(AAG)14 scaffold_19:
606139–606624
I
S60F
GGCGTTTAAAGGCGTTTAAA
S61R
CGTCTTCTTCTTGACGCACA
(AC)18 scaffold_52:
422559–422915
I
S64F
YTTGCGACTAGCAAAGTGG
S65R
CGAACTCCTTGTACAGGATGG
(AG)14 scaffold_56:
179585–179895
E
S66F
GCAGYAGGCCCGGCCT
S67R
GGAGTTCGCCATCAACAACT
(AAG)11 scaffold_12:
130593–130967
E
S68F
CGTCGGTGGAGTAAACATCA
S69R
AAAGGCGTTCGGAGAGYTG
(AG)14 scaffold_66:
83968:84423
I
S70F
ATGACGAGGCAGCAGTTGAC
S71R
AAGAACWGCGTSTACCTGCG
(ATC)13 scaffold_2:
564977–565285
I
S72F
GCARCAATCTTCTGCTTYTTC
S73R
ACACCTSCGTACWTTCGTCA
(AAC)12 scaffold_92:
221631–221935
I
S74F
CGGTGGTACTTGTCGTCCTC
S75R
TSTCCGGCTACATCATCATC
(ATT)12 scaffold_41:
327977–328190
I
S76F
GCATCTACGACCAGATCTACCC
S77R
GTAGACSGAGATGATGGCGT
(AC)8 scaffold_127:
112530–112930
I
  1. (a) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html.
  2. (b) E = exons; I = Introns