Skip to main content

Advertisement

Table 7 Set of primers designed with the 2nd approach (Fig. 1B) to amplify genomic regions potentially containing SSRs in Phytophthora species of clade 7 [2].

From: Use of genome sequence data in the design and testing of SSR markers for Phytophthora species

Forward primer Reverse Primer SSRs Source(a) Gene(b)
S38F TCGTSTTCTACGTGCTGGAY S39R GTAGCACGCGAACATGAASA (AAC)18 scaffold_26: 667079–667377 E
S40F TTCCTTAAGTGGGGGAGGAT S41R TRTCGGCRTTCAGCTTCTGT (AAG)4; (AAG)22 scaffold_125: 153837–154222 I
S42F GCTGCAAGAGTCSCTCGAGTA S43R CTTGAGGATGTCRATGAGCA (AG)21 scaffold_89: 132819–133248 I
S44F GTRGCTCCTTCCTTAAGTGG S45R GTGCTGCASGTAYGGCTTC (AAG)17 scaffold_75: 344500–344901 I
S46F GTTGCGCGTGAGGTTCTC S47R CAAAAGCTCTGCGTCC (AG)22 scaffold_67: 282390–282656 I
S48F YCGGGCSACGGTAGG S49R AAGAGCGTRAGCAGGAACC (AG)18 scaffold_65: 225236–225440 I
S50F GTGGCTTCCACTGYTGCTG S51R YATCAAGGACGTCAACTCGA (AAC)9; (AACAGC)23 scaffold_48: 118994–119610 E
S52F CGGGATTTRTCRGATCAGG S53R CTGTYTGATCARCTCTCCGCT (AGG)19 scaffold_46: 153312–153646 E
S56F CACGAGCTGCAGKCATAYCT S57R AGAATKGAMGCGATCGAC (AGG)16 scaffold_21: 370731–371140 E
S58F TCGATCRACAGAAGCTGCWA S59R GGAGTTCGCCATCAACAACT (AAG)14 scaffold_19: 606139–606624 I
S60F GGCGTTTAAAGGCGTTTAAA S61R CGTCTTCTTCTTGACGCACA (AC)18 scaffold_52: 422559–422915 I
S64F YTTGCGACTAGCAAAGTGG S65R CGAACTCCTTGTACAGGATGG (AG)14 scaffold_56: 179585–179895 E
S66F GCAGYAGGCCCGGCCT S67R GGAGTTCGCCATCAACAACT (AAG)11 scaffold_12: 130593–130967 E
S68F CGTCGGTGGAGTAAACATCA S69R AAAGGCGTTCGGAGAGYTG (AG)14 scaffold_66: 83968:84423 I
S70F ATGACGAGGCAGCAGTTGAC S71R AAGAACWGCGTSTACCTGCG (ATC)13 scaffold_2: 564977–565285 I
S72F GCARCAATCTTCTGCTTYTTC S73R ACACCTSCGTACWTTCGTCA (AAC)12 scaffold_92: 221631–221935 I
S74F CGGTGGTACTTGTCGTCCTC S75R TSTCCGGCTACATCATCATC (ATT)12 scaffold_41: 327977–328190 I
S76F GCATCTACGACCAGATCTACCC S77R GTAGACSGAGATGATGGCGT (AC)8 scaffold_127: 112530–112930 I
  1. (a) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html.
  2. (b) E = exons; I = Introns