Skip to main content

Table 1 Alignment of promoter regions from sporozoite-expressed genes containing PfM24.1.

From: In silico discovery of transcription regulatory elements in Plasmodium falciparum

Locus Description Start Sequence End
MAL13P1.125 - -312 tatatttttttttataaggaCATGCAC ttaatttttaaaagattttc -358
MAL13P1.212 - -767 ttttaaaatttttcttaaagCATGCAC aattaagaagacgaaaaaac -813
MAL8P1.6 - -55 ttttttttttcttagttataCATGCAA aataaataaataagtttata -9
PF08_0088 S23 -486 caaattttttttttctcctgCATGCAG catttatatattaacttcaa -532
PF08_0088 S23 -529 aagttaatatataaatgctgCATGCAG gagaaaaaaaaaatttgatt -483
PF10_0218 citrate synthase -936 tagctcaaccaaaacataagCATGCAA tatatttttatacttttata -890
PF10_0231 - -427 tttaaatcttcataccaacaCATGCAC aaaagaaataaaaaattaca -381
PF11_0328 - -756 tatattataaatactctctgCATGCAA tatatatgtatattactcca -710
PF11_0480 S22 -131 ttgtcctatccaaaaattgaCATTCAG agttatagaaaaaaaatata -85
PF11_0486 MAEBL -828 attttcttcatataagaacaCATGCAG atttttattattgtctattt -874
PF13_0201 SSP -851 gaatcagatttattcaaacgCATGCTG ttttaaaataaaaaaaaaaa -897
PF14_0074 - -837 atataaagctacaatacaccCATGCAT caacaatatatcctattttg -791
PF14_0074 - -449 tctgttttttttgtcatttaCATGCAT tttatggttgtaaaatgaac -495
PF14_0427 - -414 aaaaaaaaaaaatatacataCATGCAT acataagtttctatttttca -460
PF14_0427 - -325 aaaattttgtatgtattataCATGCAT attattataatatggtttta -279
PF14_0729 - -521 tttgtccatttataaattagCATGCAA tctatgtctgatattaaaca -475
PFA0200w TSRP -265 ataattacatatttggtctaCATGCAT atacaagacaatatattgta -219
PFA0205w S24 -900 aatgaacatatattagcttaCATGCAA aaagaaaaaaaatatatatt -854
PFA0380w Kinase -986 ttttttttttttttttgaaaCATGCAT tgttttattcttaaaaaata -940
PFB0325c SERA -691 atttatgagctgaattgttaCATGCAT taaaaatggcaatgggaaat -737
PFC0210c CSP -708 tgggattattgtaaatataaCATGCAC attttgtataagttccttaa -662
PFC0210c CSP -606 cagaaattattcttatcttaCATGCAC atataaaaaaatggattggt -560
PFD0215c Pbs36 -399 gtgagttctacatgccactgCATGCTG atataaaataaattaaaaaa -353
PFD0235c S10 -471 tatctaggcacgtttcatcaCATGCAT aaaaaaataaaaaataaaaa -517
PFD0425w S17 -897 gattgttatatttatcgttaCATGCAT gtttcctaattttttttttt -851
PFD0425w S17 -850 aaaaaaaaaaaattaggaaaCATGCAT gtaacgataaatataacaat -896
PFD0430c Ppl1 -578 ttttttttaaataaatcatgCATGCAC atataattatatttttgtct -532
PFE0360c s14 -915 aataacatcttgtattgtcaCATGCAA aatgaaattatcacatttat -869
PFE0565w - -765 tatatcaaaaacgagacatgCATGCAA ttcattttgattcaattgtt -719
PFE0950c - -396 tttccattttttttcctgaaCGTGCAG gaatttaaatattattaatt -350
PFL0065w - -283 aaaaaagaaaccataatatgCATGCAC atattaataaatatatatat -237
PFL0370w - -505 aactctctttttttatataaCATGCAT gttgtagagctgtatataaa -459
PFL0370w - -458 ttttatatacagctctacaaCATGCAT gttatataaaaaaagagagt -504
PFL0630w - -376 atatattattaaaatgtgatCATGCAA aaaaaatgaaaaaacattat -330
PFL0800c S4 succinate dehydrogenase -804 tttttttcgctttatttatgCATGCAA ataagttgatattcctgaac -758
PFL1770c - -748 ctgatatataataatggggtCATGCAG gtattgaaatacacttaaaa -794
chr1.rRNA-1-28s - -868 aatagtatcggtgtaatttaCATTCAG cattctgatgatttacagta -914
  1. Motifs are highlighted in bold. Start and stop locations are relative to start codons.