Identification of novel homologous microRNA genes in the rhesus macaque genome

BMC Genomics

Table 3 Rhesus MiRNA Gene Families

MiRNA	Mature MiRNA^a	Chr	Strand	Positions in Chr^b
mml-miR-let-7a-1	UGAGGUAGUAGGUUGUAUAGUU	15	+	105917273 – 105917352
mml-miR-let-7a-2		14	-	120554305 – 120554376
mml-miR-let-7a-3		10	+	90121100 – 90121173
mml-miR-7-1	UGGAAGACUAGUGAUUUUGUUG	15	-	92701750 – 92701859
mml-miR-7-2		7	+	68219893 – 68220002
mml-miR-7-3		19	+	4659068 – 4659177
mml-miR-9-1	UCUUUGGUUAUCUAGCUGUAUGA	1	-	135024723–135024811
mml-miR-9-2		6	-	84955411–84955497
mml-miR-9-3		7	+	68995340 – 68995429
mml-miR-513-1	UUCACAGGGAGGUGUCAUUUAU	X	-	145346049–145346177
mml-miR-513-2		X	-	145354602–145354730
mml-miR-513-3		X	-	145337083–145337214
mml-miR-202a	CCACCACCAUGUCUGACACUUU	X	-	121787204–121787314
mml-miR-202b	CCACCACCG UGUCC GACACC UU	18	+	2383348 – 2383458
mml-miR-202c	CCACCACUG UGUCUGACACC UU	20	-	88058741–88058838
mml-miR-202d	CCACCACCG UGUCUGACACC UU	4	+	3002388–3002492

a: Individual genes within a miRNA gene family have the same or different mature miRNA sequences (bold letters indicate the different nucleotides comparing with the mml-miR-202a).
b: position of rhesus miRNA genes in the genome can be found at [27].

ISSN: 1471-2164