Skip to main content

Table 4 Primer pairs used for amplification of target genes by RT-PCR

From: Age dependent changes in the LPS induced transcriptome of bovine dermal fibroblasts occurs without major changes in the methylome

Gene Forward primer sequence Reverse primer sequence Reference
CD14 CTCCAGCACCAAAATGAC TCCTCTTCCCTCTCTTCC [40]
IL-8 GCTGGCTGTTGCTCTCTTG AGGTGTGGAATGTGTTTTTATGC [41]
TNF TCTTCTCAAGCCTCAAGTAACAAGC CCATGAGGGCATTGGCATAC [42]
TLR4 ACTGCAGCTTCAACCGTATC TAAAGGCTCTGCACACATCA [13]
B-Actin GCAAATGCTTCTAGGCGGACT CAATCTCATCTCGTTTTCTGCG [41]