Skip to main content

Table 1 List of primers used for quantitative real-time polymerase chain reaction

From: Transcriptome analysis of hen preadipocytes treated with an adipogenic cocktail (DMIOA) with or without 20(S)-hydroxylcholesterol

Name Forward Reverse Product length (base pair) Annealing temperature (°C)
FABP4 GAGTTTGATGAGACCACAGCAGA ATAACAGTCTCTTTGCCATCCCA 106 57
IGFBP7 TCCATCGTGACCCCTCCTAA GAGAGATCAGTACCCAGCCG 228 55
VEGFc AAGTGTGTGTGGATGTGGGG TGACAGTTACGGGTTTGGGG 201 55
CD44 CGCTGTGCGGAGATACAGAA CCTATGGCTCTTCCTGGCTG 199 55
MMP1 GCAGTCTCCTCTGCTTTCCC GTCACGGTCAGGTTTCCCAG 209 58
STARD4 GGGACAGCACAAGCCCTAAT GCCTAGCTTGACTGGGTTCA 219 54
INSIG1 GCATGGTGCCAGTGTGAAAG TCCAGAGAACAGCCATACGC 222 54
GAPDH GCTAAGGCTGTGGGGAAAGT TCAGCAGCAGCCTTCACTAC 116 55
TGM4 TGGATGTCCTCTGACTCCGT CAGTAGACCTTGTCGGCGTT 238 54
CCL4 CTCATGGCAGGTGCTGTTTG CCTCCCTTAAATGCCCTCCC 207 55
TNFAIP3 CAGAAAAGAGGCCTGCTCCA CCTTCAGTTTCTCGGGTGCT 202 54
GSTA3 GCCAAAGGAAACCACGCCTA GTTTCATCCAGTGTACCGCCT 218 55
APOA1 CTCGCTGTGCTCTTCCTGAC GTCAGCCAGCTTCAGGTCAA 191 55
KLF2 CTTACCCGCCACTACCGAAA TTGTCCGGCTCTGTCCTAAG 123 58
HAS2 CACTGGGAGAAGCGTGGAAT GCACTGTACGCAGCCAAAAT 203 56